ID: 1203364313

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:243779-243801
Sequence TAGGCGAGTGACGGTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203364313_1203364325 12 Left 1203364313 Un_KI270442v1:243779-243801 CCCACCACACCGTCACTCGCCTA No data
Right 1203364325 Un_KI270442v1:243814-243836 CAGCTTCCTCGGCATCACCGTGG No data
1203364313_1203364320 1 Left 1203364313 Un_KI270442v1:243779-243801 CCCACCACACCGTCACTCGCCTA No data
Right 1203364320 Un_KI270442v1:243803-243825 CCTTGCCCCGCCAGCTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203364313 Original CRISPR TAGGCGAGTGACGGTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr