ID: 1203367876

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:274141-274163
Sequence CACTGTGTGCAGGTTGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203367873_1203367876 -6 Left 1203367873 Un_KI270442v1:274124-274146 CCCTCTAGAATACAGGTCACTGT No data
Right 1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG No data
1203367874_1203367876 -7 Left 1203367874 Un_KI270442v1:274125-274147 CCTCTAGAATACAGGTCACTGTG No data
Right 1203367876 Un_KI270442v1:274141-274163 CACTGTGTGCAGGTTGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203367876 Original CRISPR CACTGTGTGCAGGTTGCACA AGG Intergenic
No off target data available for this crispr