ID: 1203370351

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:297900-297922
Sequence ATGGCCTAGTAGATCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203370351_1203370358 1 Left 1203370351 Un_KI270442v1:297900-297922 CCCTCACAGATCTACTAGGCCAT No data
Right 1203370358 Un_KI270442v1:297924-297946 ACCCAGTGGGGAGCCTGCCTGGG No data
1203370351_1203370357 0 Left 1203370351 Un_KI270442v1:297900-297922 CCCTCACAGATCTACTAGGCCAT No data
Right 1203370357 Un_KI270442v1:297923-297945 GACCCAGTGGGGAGCCTGCCTGG No data
1203370351_1203370360 2 Left 1203370351 Un_KI270442v1:297900-297922 CCCTCACAGATCTACTAGGCCAT No data
Right 1203370360 Un_KI270442v1:297925-297947 CCCAGTGGGGAGCCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203370351 Original CRISPR ATGGCCTAGTAGATCTGTGA GGG (reversed) Intergenic
No off target data available for this crispr