ID: 1203370436

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:298432-298454
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203370436_1203370440 16 Left 1203370436 Un_KI270442v1:298432-298454 CCCATATCCTGCTTGAGTTCCTC No data
Right 1203370440 Un_KI270442v1:298471-298493 TATATTTCAGCCACATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203370436 Original CRISPR GAGGAACTCAAGCAGGATAT GGG (reversed) Intergenic
No off target data available for this crispr