ID: 1203371376

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:308829-308851
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 17, 1: 31, 2: 74, 3: 156, 4: 510}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203371376_1203371385 25 Left 1203371376 Un_KI270442v1:308829-308851 CCTCCAGTCACTGTGCTCTCCCT 0: 17
1: 31
2: 74
3: 156
4: 510
Right 1203371385 Un_KI270442v1:308877-308899 GTTGTGTGGCTGCTGCTAGGTGG No data
1203371376_1203371383 11 Left 1203371376 Un_KI270442v1:308829-308851 CCTCCAGTCACTGTGCTCTCCCT 0: 17
1: 31
2: 74
3: 156
4: 510
Right 1203371383 Un_KI270442v1:308863-308885 ACAGGTTTCTCTGTGTTGTGTGG No data
1203371376_1203371386 26 Left 1203371376 Un_KI270442v1:308829-308851 CCTCCAGTCACTGTGCTCTCCCT 0: 17
1: 31
2: 74
3: 156
4: 510
Right 1203371386 Un_KI270442v1:308878-308900 TTGTGTGGCTGCTGCTAGGTGGG No data
1203371376_1203371384 22 Left 1203371376 Un_KI270442v1:308829-308851 CCTCCAGTCACTGTGCTCTCCCT 0: 17
1: 31
2: 74
3: 156
4: 510
Right 1203371384 Un_KI270442v1:308874-308896 TGTGTTGTGTGGCTGCTGCTAGG No data
1203371376_1203371378 -7 Left 1203371376 Un_KI270442v1:308829-308851 CCTCCAGTCACTGTGCTCTCCCT 0: 17
1: 31
2: 74
3: 156
4: 510
Right 1203371378 Un_KI270442v1:308845-308867 TCTCCCTCTCCCAAATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203371376 Original CRISPR AGGGAGAGCACAGTGACTGG AGG (reversed) Intergenic
900964242 1:5946714-5946736 AGGGGGAGGAGAGTGACTGAAGG + Intronic
901127363 1:6939012-6939034 AGGGCGAGGACTGTGCCTGGTGG - Intronic
901638536 1:10681531-10681553 AGGGAGAGGACAGTCCCGGGAGG - Intronic
902172857 1:14627136-14627158 AGGGAAATCAGAGTGGCTGGGGG + Intronic
902383657 1:16064465-16064487 AGGGAGAGCAGAGCCTCTGGGGG - Intronic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
902808155 1:18873501-18873523 AGGGAGGGCAGAGGGGCTGGAGG + Intronic
904381086 1:30111665-30111687 GGGCAGAGCTCAGTGGCTGGAGG - Intergenic
904459492 1:30667734-30667756 AGGCAGAGCACACTGGCAGGCGG - Intergenic
904647330 1:31977744-31977766 AGGGACAGCACAGTGGCCCGGGG + Intergenic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905106900 1:35568929-35568951 AGGGAGAGCACCCTGACAGCAGG - Intergenic
905353378 1:37363117-37363139 AGCGGGAACACAGAGACTGGCGG - Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905930591 1:41784119-41784141 AGGGAGAGCAGGGTTCCTGGGGG + Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907525644 1:55052524-55052546 AGGGAGGGGACAGTGACAGCTGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908432834 1:64075549-64075571 ATGTATAGGACAGTGACTGGAGG - Intronic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
915310749 1:155004818-155004840 AGGGAGGGGACAGTGTCTGGGGG - Intronic
915493174 1:156263041-156263063 AGGGAGAGAACATTGAGTAGAGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
916420815 1:164636091-164636113 AGGGGGTGCCCACTGACTGGAGG - Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917500149 1:175578369-175578391 AGGGAGAGGAAAGGCACTGGAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919122293 1:193356347-193356369 AGCCAGAACATAGTGACTGGTGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919257592 1:195143401-195143423 GGGGAGAGCACAGGGACCGGAGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920377609 1:205517589-205517611 AGAGATAGAACAGTCACTGGAGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921264753 1:213412889-213412911 AGAAAGAGCACTGTGGCTGGGGG - Intergenic
921449851 1:215292324-215292346 AGTGAGAGGATAGTGACAGGTGG - Intergenic
921678670 1:218006237-218006259 AGGAAGAGTAGAGTGACTGAGGG - Intergenic
922340527 1:224651471-224651493 ATGGAGGGGACAGTGGCTGGAGG - Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922436587 1:225613413-225613435 GGGCAGAGAACAGTGCCTGGTGG + Intronic
923069487 1:230549542-230549564 ATGGAGTGCACAGAGCCTGGCGG + Intergenic
923110378 1:230885296-230885318 AGGGAGAGAACATAGCCTGGAGG - Intergenic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
923638513 1:235725652-235725674 AGGGAAAGCAGAGTCTCTGGAGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064261370 10:13788928-13788950 AGGGAGAGCAGGGAGAATGGAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067450174 10:46377176-46377198 AGGGAGAGCCCAGTGCTGGGTGG + Intronic
1067587068 10:47482587-47482609 AGGGAGAGCCCAGTGCTGGGTGG - Intronic
1067634128 10:47990354-47990376 AGGGAGAGCCCAGTGCTGGGTGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068556038 10:58460089-58460111 AAGGAGAGCACAGAGACAGAAGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069631012 10:69897074-69897096 GGGAAGAGCACAGTGACAGAAGG + Intronic
1069881055 10:71593657-71593679 TGGGAAACCCCAGTGACTGGTGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070835745 10:79445813-79445835 AGGGCGAGGACAGTGCCAGGCGG - Intergenic
1071268768 10:83987552-83987574 TGGGAGTGCACATTGGCTGGTGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072265160 10:93720202-93720224 AGGCAGAGCACAGACTCTGGGGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1073042669 10:100618077-100618099 AGAGAGAGGACAGTGCCTTGAGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075265504 10:120997215-120997237 AGGAAGACCACAGTGTCAGGGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075677450 10:124305282-124305304 AGCTAGAGCACAGTGACTCAAGG + Intergenic
1075982778 10:126755688-126755710 TGGGTGAGGACAGTGACTGCTGG - Intergenic
1076067905 10:127463739-127463761 AGGGAGGGCACAGGGACAGCAGG - Intergenic
1077391460 11:2302422-2302444 AGGGGCAGCACAGAGCCTGGAGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1077954085 11:6994641-6994663 AGTGACAGCACAGTGGCTGAAGG - Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1081587597 11:44398121-44398143 AGGGCGGGCACAGGGACTTGCGG - Intergenic
1083477445 11:62923359-62923381 AGGGAGACCAAGGAGACTGGGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1083618587 11:64038030-64038052 AGTGACAGCACACTGGCTGGTGG - Intronic
1084792122 11:71481570-71481592 AAGGTGGGCACAGTGGCTGGTGG + Intronic
1084859894 11:72011447-72011469 AGGAAGAGCACAGGGAGTAGGGG + Intronic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087746756 11:101956477-101956499 AGGGAGAGAACTGAGGCTGGTGG - Intronic
1087811204 11:102610965-102610987 AGGGAAAGCAGTGTGACTCGGGG - Intronic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089393257 11:118116383-118116405 AGGGAGCTCACAGTGGTTGGGGG + Intronic
1089456893 11:118631100-118631122 AGGGAGAGCAGGGTTACAGGGGG - Intronic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1090501242 11:127263534-127263556 GGGGAGCTCACAGTGGCTGGAGG - Intergenic
1090582843 11:128178857-128178879 AGGGAGTCCACAGTAAGTGGGGG - Intergenic
1091171804 11:133526275-133526297 AGGGAGAGCACCAAGGCTGGGGG + Intronic
1091647584 12:2285436-2285458 AGGGAGAGCCCAGGTAGTGGAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1093699031 12:22196915-22196937 TGGGAGAGGACAGAGACTGACGG + Exonic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096007520 12:48184580-48184602 GGGGCGCTCACAGTGACTGGAGG - Exonic
1096480068 12:51934224-51934246 AGGGAGTCCAGAGTGGCTGGAGG - Intergenic
1097229057 12:57498121-57498143 AGGAAGAGAACAGTGCATGGGGG - Intronic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099636693 12:85222656-85222678 AGAGAGAGAAGAGTCACTGGAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100282190 12:93128482-93128504 GGCGCCAGCACAGTGACTGGAGG - Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1101814775 12:108137483-108137505 AGAGAGTGCACAGTGACAGCAGG + Intronic
1103171405 12:118823266-118823288 AGTGTGAGCACAGGGACTGATGG + Intergenic
1103415581 12:120740003-120740025 AGGGCGAGGACACAGACTGGGGG - Exonic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1103615269 12:122147879-122147901 AGGGGAACCACAGTGCCTGGAGG - Intergenic
1104057107 12:125239036-125239058 AGGGAGAGCATGGTGAGGGGCGG + Intronic
1104720728 12:131043774-131043796 CCGGAGGGCATAGTGACTGGAGG + Intronic
1105280157 13:18958659-18958681 ACCCTGAGCACAGTGACTGGGGG + Intergenic
1105503596 13:20992023-20992045 GGGAAGAACACAGGGACTGGTGG + Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106406656 13:29480525-29480547 AAGGAGGCCACAGTGGCTGGAGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109117045 13:58401602-58401624 AGGTAGAGCTCTGTGATTGGTGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111868937 13:93805991-93806013 AAGGAGAGCACAGTGACCTAAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114430859 14:22659164-22659186 AGGGAGAGCAGAGATGCTGGAGG - Intergenic
1115013858 14:28585962-28585984 AGTGAGAGCACTGTATCTGGAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118509348 14:66453939-66453961 AGAGAGAACAGGGTGACTGGAGG + Intergenic
1119546986 14:75479194-75479216 AGGGAGGGCACAGTCTCTCGGGG + Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121050721 14:90817140-90817162 GGGGAAGGCACAGTCACTGGTGG + Intergenic
1121544955 14:94756371-94756393 AGAAAGAGCAGAGTGTCTGGTGG + Intergenic
1121555092 14:94830422-94830444 AAGGAGAGCAGAGAGACTGGGGG - Intergenic
1122070280 14:99201559-99201581 AGGGCCAGGACAGGGACTGGGGG - Intronic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1122594359 14:102879004-102879026 AGGGGGTGCCCAGTGAGTGGAGG + Intronic
1124194535 15:27609945-27609967 ATGGTGAGCACAGTGCCTGCTGG - Intergenic
1125193421 15:37019662-37019684 AGGGAGAGCATAGTGTGGGGAGG + Intronic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1127132527 15:55882364-55882386 TGGGAGAGCTCAGTGACAGTGGG + Intronic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1129264731 15:74387549-74387571 AGAGAGAGCACATGGACCGGCGG + Intergenic
1129462845 15:75708478-75708500 AGGGAGAGAACGCTGGCTGGTGG + Intronic
1129722029 15:77882938-77882960 AGGGAGAGAACGCTGGCTGGTGG - Intergenic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130336250 15:82959437-82959459 AGGCAGAGCACAGTCATTGCAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1132201443 15:99957035-99957057 AGGGGGAGCACATTGCCTGAAGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1132499669 16:279916-279938 AGGGAGAGGACACTGACAAGGGG - Intronic
1132723117 16:1326559-1326581 ACCGAGAGCTCAGTGACTGCAGG - Exonic
1133276728 16:4642744-4642766 GGGGTGAGCACCGTGCCTGGTGG + Intronic
1133713068 16:8420095-8420117 AGAGAGAGAATAATGACTGGAGG + Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1135300141 16:21319717-21319739 AGGTAGATGACAGTGGCTGGAGG - Intergenic
1135388862 16:22071221-22071243 AGGGAGAGCCCCGTGAGAGGAGG + Intronic
1135480011 16:22814433-22814455 AGGGTGCGCACAGTGCCAGGGGG - Exonic
1136119144 16:28118805-28118827 AGGAAGTGCTCAGTGACTGTTGG - Intronic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137023790 16:35454361-35454383 AGGCAGAGCAGTGTGAGTGGGGG - Intergenic
1138194987 16:55045385-55045407 ATGGAGAGCAGAGGGCCTGGAGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140234974 16:73150676-73150698 AGGGGTATCAGAGTGACTGGTGG + Intergenic
1141398217 16:83723603-83723625 AGGGAGTGACCAGTGACAGGTGG - Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1142398955 16:89849197-89849219 AGGAAGTGGACAGTGCCTGGGGG + Intronic
1203141172 16_KI270728v1_random:1767797-1767819 AGGGAGAGCTGTGTTACTGGTGG + Intergenic
1142497911 17:316129-316151 AGGTGGAGCACAGGGACTGCAGG - Intronic
1142682328 17:1557426-1557448 AGACGGAGCCCAGTGACTGGAGG + Intronic
1143030747 17:3965604-3965626 AGGAAGAGCACAGAATCTGGGGG - Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144702690 17:17349276-17349298 AGGGAGAGCCCCGGGCCTGGGGG + Intergenic
1144858478 17:18284388-18284410 AGGAAGAGCAGAGGGGCTGGAGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146980858 17:37160158-37160180 AGGGGAGGGACAGTGACTGGAGG + Intronic
1148037730 17:44680722-44680744 AGGAAAAGCACACTGAATGGAGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149332596 17:55601997-55602019 AGAGAGAGCTCAGTGGCTTGTGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152741959 17:82022389-82022411 AGGGAAACCACTGTGCCTGGCGG + Intronic
1152963515 18:95532-95554 TGGGAGCGCTCAGGGACTGGGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153856008 18:9147632-9147654 AGTGAGAGCAGTGTGACTAGAGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1158025099 18:52886464-52886486 ACAGACAGCACAGCGACTGGGGG - Intronic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160009083 18:75090013-75090035 AGGGAGAGCACAGTCAGAGGTGG + Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1163228580 19:15981384-15981406 CGGGAGATGACAGGGACTGGGGG + Intergenic
1163400136 19:17087179-17087201 AGGGAGACCCCAGGGCCTGGAGG + Intronic
1164572593 19:29385179-29385201 AGGGTGAACACAGGAACTGGAGG + Intergenic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1165829867 19:38725156-38725178 AGTGAGTGCTCAGTGAGTGGTGG - Intronic
1166305029 19:41932616-41932638 GGGGAGAGCAGAGGGAATGGGGG + Intergenic
1167430353 19:49450721-49450743 AGGGAGAGGACAGAGAGAGGAGG - Intronic
1168553451 19:57318815-57318837 AGAGAGTGCACTGTGGCTGGGGG + Intergenic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927108731 2:19849193-19849215 AGGGAAAGCTCAGGGAATGGAGG + Intergenic
927193237 2:20531357-20531379 GGGTAGAGCACAGTGCCTGCAGG - Intergenic
927570405 2:24154005-24154027 AGGGTGAGCCCAGTGAGTAGGGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930475350 2:51875149-51875171 AGAGAGGACACAGTGGCTGGGGG + Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931151173 2:59575114-59575136 AGGGAGACTAGTGTGACTGGAGG + Intergenic
931411935 2:62041095-62041117 AGGAAGAGCAAAGTTTCTGGTGG - Intronic
931427689 2:62185878-62185900 AGGTAGAGCCCTGTGTCTGGGGG + Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932627508 2:73309285-73309307 ACTGAGAGCACAGTGACAAGGGG - Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934607736 2:95710270-95710292 GGAGAGAGCACACTGACTGAGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936541077 2:113352150-113352172 GGAGAGAGCACACTGACTGAGGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
940538565 2:154980077-154980099 ATGGAGTAAACAGTGACTGGAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940803433 2:158157681-158157703 AGGGAGAACACTGGGAGTGGGGG - Intergenic
940905036 2:159161234-159161256 AGGGAGAGCACTTTGACTTTTGG + Intronic
940987746 2:160065121-160065143 AGGGAGGGCTCAGTGCCTGCTGG + Intergenic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942632997 2:177972279-177972301 AGGAAGAGAACAGTGACAGAAGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944613989 2:201441661-201441683 AGAAAGAGCACACTGTCTGGAGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945962056 2:216145971-216145993 AGGGAGAGCACTGTGAATAAAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948726308 2:239936145-239936167 AGAGAGTGAACAGTGACTGTTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948794714 2:240396417-240396439 AGGGAAAGCTCAGTAAATGGTGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169459957 20:5785941-5785963 AAGGAGAGCACAGTGAAGAGTGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169933523 20:10858622-10858644 AGGCACAGCACAATCACTGGAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170334955 20:15259438-15259460 AGATATAGCACTGTGACTGGGGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171979510 20:31617645-31617667 AAGGAAACCAAAGTGACTGGAGG - Intergenic
1172778443 20:37421713-37421735 AGGGAGACAAAAGTGAGTGGAGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174691686 20:52512472-52512494 AGGGAAAGGACACTGACTTGGGG - Intergenic
1175067057 20:56298036-56298058 GGAGAGAGCAGGGTGACTGGTGG + Intergenic
1175132397 20:56799255-56799277 AGCATGAGCACAGTGAGTGGAGG + Intergenic
1175540046 20:59742757-59742779 AGGGAGAGCAGCGTGGGTGGAGG + Intronic
1175853605 20:62107069-62107091 AAGGAGACCAGAGTGGCTGGAGG - Intergenic
1176060892 20:63172497-63172519 GGGGGGGGCACAGAGACTGGGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177106998 21:16969316-16969338 AAGTTGAGGACAGTGACTGGGGG + Intergenic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1179792038 21:43761409-43761431 AGGGCAAGCCCAGTGTCTGGCGG + Exonic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180595993 22:16973774-16973796 AGGAAGAGCACAGGGTCTGCTGG - Intronic
1183191428 22:36324101-36324123 AGGGCGAGCACAGGCAATGGAGG - Intronic
1184468343 22:44681951-44681973 CCTGAGAGCACAGTGGCTGGAGG + Intronic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950151746 3:10692849-10692871 AGTGAGTGCACAGTGTCTGGCGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950495847 3:13333940-13333962 AGGGAGAAAACAGGGAGTGGCGG + Intronic
950543774 3:13627106-13627128 AGAGATGGCAGAGTGACTGGGGG + Intronic
950739018 3:15034808-15034830 AGGTAGGGCACAGGGACTTGGGG + Exonic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951172253 3:19555548-19555570 AGGGAATGCTCGGTGACTGGGGG - Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953643941 3:44736183-44736205 AAGGAGAGAACAGTGTCTTGGGG + Exonic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954688868 3:52385271-52385293 AGAGAGAGCACAGGGCCTGCTGG - Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
956318974 3:67974116-67974138 AGGTAGAGGAGAGTGACTGATGG - Intergenic
956531688 3:70226879-70226901 AAGGAGAGAAGAGGGACTGGTGG + Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959215659 3:103447625-103447647 AAAGAGAGCACCGTAACTGGAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960786089 3:121373831-121373853 GTGGAGTGCACAGAGACTGGTGG - Intronic
961771408 3:129252771-129252793 AGGCAGCCCACACTGACTGGTGG - Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962370590 3:134817883-134817905 GGGGAAAGCGCAATGACTGGCGG + Intronic
962709018 3:138070126-138070148 AGGGAGGGGACAGGGACTTGGGG - Intronic
962812531 3:138971996-138972018 TGGCAGAGGTCAGTGACTGGAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963393435 3:144699793-144699815 AAGGAGAGCACAGTCAAGGGAGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965187772 3:165487490-165487512 AGGGAGGGGAGAGGGACTGGAGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966410684 3:179643196-179643218 TTGGAGAGCACAGTCACTAGAGG - Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966824323 3:183951320-183951342 CCTGAGAGCACAGTGACTGCTGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968663687 4:1809613-1809635 AGGGAGAGCAGAGGGGATGGGGG - Intergenic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
968902040 4:3436459-3436481 AGGCTGAGCAAAGTGCCTGGGGG + Intronic
969544331 4:7814771-7814793 AGAAAGAGCACAGGGGCTGGGGG + Intronic
970026520 4:11629855-11629877 AGGGAGAACACAGAGAAGGGCGG + Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
970617551 4:17781790-17781812 GGACAGGGCACAGTGACTGGCGG + Intergenic
970617560 4:17781824-17781846 GGACAGGGCACAGTGACTGGCGG + Intergenic
971401376 4:26278917-26278939 AAGGAGGCCACAGTGCCTGGTGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975696480 4:77019086-77019108 AGGGAGAAGATAGAGACTGGTGG + Intronic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
976266778 4:83192586-83192608 AGGGAGAGAACAGGGGCTGAAGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979717727 4:123861897-123861919 AGGAAGAGCACTGATACTGGAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
984802749 4:183729755-183729777 AAGGAGAGCAGGGTGAGTGGGGG + Intergenic
985529394 5:424919-424941 AGGGGGACCACAGTGCCTGGAGG - Intronic
985880934 5:2638607-2638629 AGGGAAACCACCGTGAATGGAGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987640109 5:20601673-20601695 AGGGTGAGCCCTGTGACTGCCGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988771978 5:34441246-34441268 AGGGGGAGCACTGTTACTTGTGG + Intergenic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
989999892 5:50880413-50880435 ACGGAGGGCACGGTGAGTGGTGG + Intergenic
990036458 5:51326797-51326819 AGAGAGAGCACTGTGACTCACGG - Intergenic
990680146 5:58233566-58233588 ATGGGGAGCACTGTGAGTGGTGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992213851 5:74506696-74506718 AGATAGAGCACAGGCACTGGAGG + Intergenic
992257263 5:74933441-74933463 AGGGAGAGCACAGGAAATCGGGG + Intergenic
992402554 5:76424988-76425010 AAGGAGAGCACGGTGCATGGAGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993535084 5:89074235-89074257 AGATAAAGTACAGTGACTGGAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994226050 5:97253171-97253193 AGGGAAAGTACAATTACTGGGGG + Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995042306 5:107602858-107602880 TAGAAGAGCACAGTGACTAGAGG + Intronic
995195502 5:109362644-109362666 AGGAAGAGGTCACTGACTGGAGG + Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
996192902 5:120567368-120567390 AGGTAAAGCACAGTGGCAGGAGG - Intronic
996210945 5:120808926-120808948 AGAGAGGGGACAGTCACTGGAGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997416908 5:133736053-133736075 AGGATGTGCACAGTGCCTGGAGG + Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
997840373 5:137234192-137234214 AGAGAGGCCACAGTGTCTGGGGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998958263 5:147458853-147458875 AGGGAGAACACAGTGTATAGGGG + Intronic
999085289 5:148883054-148883076 AGAGAGAGCAGGGTGAGTGGAGG - Intergenic
999435385 5:151559454-151559476 AGGAAGAGCACAAGGACTAGGGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002539837 5:179899155-179899177 AGGGTGAGAACAGAGAGTGGCGG + Intronic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1004020008 6:11768854-11768876 TGGGAGAGCACAGAGATTCGTGG - Intronic
1004332820 6:14737115-14737137 AGGGAGATCCCGGTCACTGGGGG + Intergenic
1004984609 6:21067186-21067208 GGGGAGAGGACAGTAAATGGAGG - Intronic
1005018672 6:21397508-21397530 GGGCAGAACACATTGACTGGTGG - Intergenic
1005810336 6:29510382-29510404 AGAGAGAGCACATTGTCTGCAGG + Intergenic
1006582747 6:35086216-35086238 AGGGATGGCGCAGTTACTGGGGG - Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008440257 6:51524760-51524782 AGGGAGTGCACAGGGAGTTGAGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009935024 6:70223937-70223959 GGGGAGAGCAAAGTGAGAGGAGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1014538650 6:122648128-122648150 GGGGAGCCCAAAGTGACTGGTGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016010352 6:139133091-139133113 AGGCAGAGAACAGAGTCTGGAGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017050660 6:150390692-150390714 GGGGAGACCACAGTGACTCATGG - Intronic
1017387244 6:153900692-153900714 AGGGAGAACACAGTGAACTGGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1019403098 7:867610-867632 AGGAAGTGCACGGTCACTGGAGG + Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021697388 7:23287885-23287907 AGAGAGAGCCCCGAGACTGGAGG - Intergenic
1021836901 7:24686045-24686067 AGGGAGAGCATAATTTCTGGGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022653323 7:32296972-32296994 ACGGAGAACTCAGGGACTGGAGG + Intronic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023023483 7:36031232-36031254 AGGGAGAGAACACTCACTTGTGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023873141 7:44273483-44273505 AGGGCAGGCACAGTGACAGGAGG + Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025780223 7:64595094-64595116 AAGGTGAGCAACGTGACTGGGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028134488 7:87211225-87211247 AGGAAGAACAAAGTGCCTGGAGG - Intronic
1028179191 7:87697895-87697917 AGGGGAAGCAGGGTGACTGGTGG - Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1030987882 7:116263479-116263501 AGGGAGAGAAGAGTGGCTGAAGG - Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031417366 7:121509826-121509848 GGGGAGAGCAGAGTGAGTTGGGG + Intergenic
1031560825 7:123235927-123235949 AGGGAGACCACAATGACCAGGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1031991055 7:128199483-128199505 AGGGAGATCTCAGTTACTGCTGG + Intergenic
1032023573 7:128423637-128423659 ACTGAGAGCACAGTGCCAGGTGG + Intergenic
1032128584 7:129211801-129211823 GGGGGGAGCACAGAGGCTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034276658 7:149826784-149826806 CGGGTGAGCACAGTCCCTGGGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034868094 7:154657814-154657836 AGGGAAAGGAAAGAGACTGGTGG + Intronic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1035577212 8:715508-715530 GGGGCCACCACAGTGACTGGGGG + Intronic
1035600527 8:894602-894624 GGGGAGAGCAGAGTGACAGCTGG + Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039297673 8:36174480-36174502 AGGGAGAGCTCCGGGTCTGGAGG - Intergenic
1039511814 8:38097974-38097996 AGAGAGAGCAGAGGGACAGGAGG - Intergenic
1040329950 8:46380810-46380832 AGGGAGATCACAGGGACTCAGGG + Intergenic
1040703233 8:50092954-50092976 AAGGAAAGCACTGTGGCTGGTGG + Intronic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040855742 8:51946622-51946644 AGGGATGGGACAGTGGCTGGGGG - Intergenic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1042947571 8:74170484-74170506 AGGGATAGCGCAGTCTCTGGAGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044836173 8:96297712-96297734 AGGTGGAGCACAGTTACTGGAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046196092 8:110864242-110864264 AGGGAGAGGATAGTCAGTGGGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048043731 8:130754224-130754246 AGAGAGAGGACATGGACTGGGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048290016 8:133174169-133174191 ATGGAATGCACAGTGCCTGGAGG - Intergenic
1048375111 8:133816509-133816531 AAGGACTGCACAGAGACTGGTGG + Intergenic
1048411874 8:134183266-134183288 AGGGTGAGCAGAGTGAAAGGTGG + Intergenic
1048427787 8:134338768-134338790 AGGGAGAGAAGAGAGGCTGGAGG - Intergenic
1048592953 8:135838436-135838458 AGGGAGAGCAGAGACACTAGAGG - Intergenic
1048830484 8:138472127-138472149 AGAGAGAGGACAGAGACAGGAGG + Intronic
1048840122 8:138558152-138558174 GGGGAGAGCCAGGTGACTGGGGG + Intergenic
1048982550 8:139710638-139710660 GGTGACAGCATAGTGACTGGTGG + Intergenic
1049292345 8:141811063-141811085 AGGGAGGGCAGAGGGGCTGGAGG + Intergenic
1049415242 8:142492017-142492039 AGGGTGAGGACAGTTAGTGGGGG + Intronic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049727021 8:144151771-144151793 AGGGGGAGCACAGAGACGGGAGG - Intronic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050620799 9:7450062-7450084 AAGGTCAGCCCAGTGACTGGCGG + Intergenic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051725966 9:20088637-20088659 GGAGAGTCCACAGTGACTGGAGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056390864 9:86140483-86140505 AGGCTGGGCACAGTGGCTGGTGG + Intergenic
1056775728 9:89511192-89511214 AGAGAGAGCTAAGTGCCTGGAGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1058893132 9:109378427-109378449 ATGGAGACCATTGTGACTGGGGG + Exonic
1059395721 9:114032875-114032897 AGGGAGACCACAGAGGCAGGAGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060891642 9:127192994-127193016 AGTCAGAGCTGAGTGACTGGAGG + Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061839822 9:133352124-133352146 ACAGAGAGCACAGTCCCTGGAGG - Exonic
1061896725 9:133652164-133652186 AGGGAGGACACAGTGGCCGGGGG + Intronic
1062014057 9:134282481-134282503 GGGGAGAGCCCAGAGTCTGGGGG - Intergenic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1062401940 9:136376638-136376660 AGGGAGTGCACAGTCACGTGTGG - Intronic
1062734578 9:138128194-138128216 TGGGAGCGCTCAGGGACTGGGGG - Intergenic
1203769878 EBV:44275-44297 AGAGAGTGCACAGTGACAGTGGG + Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185552871 X:997957-997979 AGGGAGAGCTGTGTTACTGGCGG - Intergenic
1186382356 X:9074200-9074222 AGGCAAAGCACAGTGACAGTGGG - Intronic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188027501 X:25226096-25226118 GGAGAGACCACTGTGACTGGGGG + Intergenic
1188112792 X:26212034-26212056 GGAGAGAACGCAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974544 X:36657455-36657477 ACAGAGAGCAAAGAGACTGGAGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189262409 X:39688166-39688188 AGAGAGAAGACAGTGTCTGGGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189683676 X:43542129-43542151 AGGGAAAGGATAGTGTCTGGCGG - Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1192560249 X:72123619-72123641 AAGGAGACCACAGTCGCTGGAGG + Intergenic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194257614 X:91653493-91653515 AGAGAGAACACAATGACCGGAGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196141469 X:112267483-112267505 ATGGAGATCACAGAGATTGGAGG - Intergenic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198283172 X:135162882-135162904 AGGGAGTTCTCAGTGAATGGAGG + Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic