ID: 1203377183

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:385308-385330
Sequence TGCAGAGATCGCGACCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203377183_1203377193 17 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377193 Un_KI270442v1:385348-385370 TTCGGGTTCCCATGCCGCCCTGG No data
1203377183_1203377189 0 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377189 Un_KI270442v1:385331-385353 GGTGGAGGTGCCCCGTCTTCGGG No data
1203377183_1203377188 -1 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377188 Un_KI270442v1:385330-385352 AGGTGGAGGTGCCCCGTCTTCGG No data
1203377183_1203377197 26 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377197 Un_KI270442v1:385357-385379 CCATGCCGCCCTGGCGACCTGGG No data
1203377183_1203377198 27 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377198 Un_KI270442v1:385358-385380 CATGCCGCCCTGGCGACCTGGGG No data
1203377183_1203377195 25 Left 1203377183 Un_KI270442v1:385308-385330 CCTCCGGGGTCGCGATCTCTGCA No data
Right 1203377195 Un_KI270442v1:385356-385378 CCCATGCCGCCCTGGCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203377183 Original CRISPR TGCAGAGATCGCGACCCCGG AGG (reversed) Intergenic
No off target data available for this crispr