ID: 1203377267

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:385634-385656
Sequence CCAGCCCAGCCAGGCTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203377267_1203377279 24 Left 1203377267 Un_KI270442v1:385634-385656 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1203377279 Un_KI270442v1:385681-385703 TGGCTCACGAAAGCCCCCACTGG No data
1203377267_1203377275 4 Left 1203377267 Un_KI270442v1:385634-385656 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1203377275 Un_KI270442v1:385661-385683 GGGGGATGGCCCTTGCTGCCTGG No data
1203377267_1203377280 25 Left 1203377267 Un_KI270442v1:385634-385656 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG No data
1203377267_1203377274 -10 Left 1203377267 Un_KI270442v1:385634-385656 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1203377274 Un_KI270442v1:385647-385669 GCTGGGCTGGAGCAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203377267 Original CRISPR CCAGCCCAGCCAGGCTGCGC AGG (reversed) Intergenic
No off target data available for this crispr