ID: 1203377280

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270442v1:385682-385704
Sequence GGCTCACGAAAGCCCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203377267_1203377280 25 Left 1203377267 Un_KI270442v1:385634-385656 CCTGCGCAGCCTGGCTGGGCTGG No data
Right 1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG No data
1203377272_1203377280 16 Left 1203377272 Un_KI270442v1:385643-385665 CCTGGCTGGGCTGGAGCAGGGGG No data
Right 1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203377280 Original CRISPR GGCTCACGAAAGCCCCCACT GGG Intergenic
No off target data available for this crispr