ID: 1203410225

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270581v1:1441-1463
Sequence TCCTATCCATGAGCATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203410225_1203410227 -1 Left 1203410225 Un_KI270581v1:1441-1463 CCACCTCATGCTCATGGATAGGA No data
Right 1203410227 Un_KI270581v1:1463-1485 AAGATCCAATATAACTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203410225 Original CRISPR TCCTATCCATGAGCATGAGG TGG (reversed) Intergenic
No off target data available for this crispr