ID: 1203416733

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270330v1:322-344
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203416733_1203416736 7 Left 1203416733 Un_KI270330v1:322-344 CCATCTACTTGCTACTGTCACAC No data
Right 1203416736 Un_KI270330v1:352-374 AGCAGAAGAGGCCCCTGTAATGG No data
1203416733_1203416734 -5 Left 1203416733 Un_KI270330v1:322-344 CCATCTACTTGCTACTGTCACAC No data
Right 1203416734 Un_KI270330v1:340-362 CACACTCTTGCCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203416733 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr