ID: 1203422652

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:8719-8741
Sequence TCTCTGAGTAGACCAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203422652_1203422657 23 Left 1203422652 Un_GL000195v1:8719-8741 CCTGCTATTGGTCTACTCAGAGA No data
Right 1203422657 Un_GL000195v1:8765-8787 TTGGAGGTGTGGATGTTTCCAGG No data
1203422652_1203422653 4 Left 1203422652 Un_GL000195v1:8719-8741 CCTGCTATTGGTCTACTCAGAGA No data
Right 1203422653 Un_GL000195v1:8746-8768 ACTTCTTCCTCGTTTAGTCTTGG 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
1203422652_1203422656 12 Left 1203422652 Un_GL000195v1:8719-8741 CCTGCTATTGGTCTACTCAGAGA No data
Right 1203422656 Un_GL000195v1:8754-8776 CTCGTTTAGTCTTGGAGGTGTGG No data
1203422652_1203422654 7 Left 1203422652 Un_GL000195v1:8719-8741 CCTGCTATTGGTCTACTCAGAGA No data
Right 1203422654 Un_GL000195v1:8749-8771 TCTTCCTCGTTTAGTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203422652 Original CRISPR TCTCTGAGTAGACCAATAGC AGG (reversed) Intergenic
No off target data available for this crispr