ID: 1203422813

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:10863-10885
Sequence TTGCAGCCCTACCACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203422811_1203422813 13 Left 1203422811 Un_GL000195v1:10827-10849 CCATTTTACCAAAGGCTAACGCT No data
Right 1203422813 Un_GL000195v1:10863-10885 TTGCAGCCCTACCACTGAAAAGG No data
1203422812_1203422813 5 Left 1203422812 Un_GL000195v1:10835-10857 CCAAAGGCTAACGCTAAAATACT No data
Right 1203422813 Un_GL000195v1:10863-10885 TTGCAGCCCTACCACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203422813 Original CRISPR TTGCAGCCCTACCACTGAAA AGG Intergenic
No off target data available for this crispr