ID: 1203424557

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:25510-25532
Sequence GTCTCCTGCTTGAAGTGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203424557_1203424559 -4 Left 1203424557 Un_GL000195v1:25510-25532 CCTAGACACTTCAAGCAGGAGAC No data
Right 1203424559 Un_GL000195v1:25529-25551 AGACAATGTGACATATCTCTGGG No data
1203424557_1203424558 -5 Left 1203424557 Un_GL000195v1:25510-25532 CCTAGACACTTCAAGCAGGAGAC No data
Right 1203424558 Un_GL000195v1:25528-25550 GAGACAATGTGACATATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203424557 Original CRISPR GTCTCCTGCTTGAAGTGTCT AGG (reversed) Intergenic
No off target data available for this crispr