ID: 1203425020

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:30029-30051
Sequence CAGCTTCAGAATTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203425020_1203425025 -3 Left 1203425020 Un_GL000195v1:30029-30051 CCCCCTACAGAATTCTGAAGCTG No data
Right 1203425025 Un_GL000195v1:30049-30071 CTGTTCATAAGCAGGCCACGTGG No data
1203425020_1203425027 29 Left 1203425020 Un_GL000195v1:30029-30051 CCCCCTACAGAATTCTGAAGCTG No data
Right 1203425027 Un_GL000195v1:30081-30103 CTCAAAAGCTGTTGAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203425020 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG (reversed) Intergenic
No off target data available for this crispr