ID: 1203425349

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:32114-32136
Sequence TAGTCTAAGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203425349_1203425352 9 Left 1203425349 Un_GL000195v1:32114-32136 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1203425352 Un_GL000195v1:32146-32168 CACTGAGCTGAGTGCATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203425349 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr