ID: 1203425647

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:34185-34207
Sequence TCCCGATGTTGGGGGAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203425642_1203425647 6 Left 1203425642 Un_GL000195v1:34156-34178 CCGTAAAAAAAGGAAATTTGTTT No data
Right 1203425647 Un_GL000195v1:34185-34207 TCCCGATGTTGGGGGAGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203425647 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG Intergenic
No off target data available for this crispr