ID: 1203426957

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:49949-49971
Sequence AAGCCTACTCACACCAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203426949_1203426957 27 Left 1203426949 Un_GL000195v1:49899-49921 CCACTGAAGGCTCAGTTGATTAT No data
Right 1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG No data
1203426954_1203426957 -9 Left 1203426954 Un_GL000195v1:49935-49957 CCCTGCAGGTGTCCAAGCCTACT 0: 6
1: 1
2: 2
3: 18
4: 140
Right 1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG No data
1203426955_1203426957 -10 Left 1203426955 Un_GL000195v1:49936-49958 CCTGCAGGTGTCCAAGCCTACTC 0: 6
1: 1
2: 2
3: 23
4: 116
Right 1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG No data
1203426953_1203426957 3 Left 1203426953 Un_GL000195v1:49923-49945 CCTGGGTGTCTGCCCTGCAGGTG 0: 6
1: 0
2: 5
3: 34
4: 338
Right 1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203426957 Original CRISPR AAGCCTACTCACACCAATCA TGG Intergenic
No off target data available for this crispr