ID: 1203430434

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:86370-86392
Sequence GGTCCTCGATGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203430431_1203430434 -7 Left 1203430431 Un_GL000195v1:86354-86376 CCAGGCCGGATGTGGGGGTCCTC No data
Right 1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG No data
1203430426_1203430434 2 Left 1203430426 Un_GL000195v1:86345-86367 CCGGATGGGCCAGGCCGGATGTG No data
Right 1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG No data
1203430423_1203430434 14 Left 1203430423 Un_GL000195v1:86333-86355 CCAGGGACAGCACCGGATGGGCC No data
Right 1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG No data
1203430422_1203430434 15 Left 1203430422 Un_GL000195v1:86332-86354 CCCAGGGACAGCACCGGATGGGC No data
Right 1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203430434 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG Intergenic