ID: 1203430953

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:90945-90967
Sequence ATGTGAAAAGAGCTGGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203430949_1203430953 -2 Left 1203430949 Un_GL000195v1:90924-90946 CCCATCGTCTTACCTCAAATGAT No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data
1203430947_1203430953 0 Left 1203430947 Un_GL000195v1:90922-90944 CCCCCATCGTCTTACCTCAAATG No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data
1203430946_1203430953 29 Left 1203430946 Un_GL000195v1:90893-90915 CCAGCGCAGTGTGACTTCTGGAG No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data
1203430945_1203430953 30 Left 1203430945 Un_GL000195v1:90892-90914 CCCAGCGCAGTGTGACTTCTGGA No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data
1203430950_1203430953 -3 Left 1203430950 Un_GL000195v1:90925-90947 CCATCGTCTTACCTCAAATGATG No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data
1203430948_1203430953 -1 Left 1203430948 Un_GL000195v1:90923-90945 CCCCATCGTCTTACCTCAAATGA No data
Right 1203430953 Un_GL000195v1:90945-90967 ATGTGAAAAGAGCTGGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203430953 Original CRISPR ATGTGAAAAGAGCTGGTTCC CGG Intergenic
No off target data available for this crispr