ID: 1203431285

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:93249-93271
Sequence GGTGGGCCTTGAGCATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203431285_1203431292 18 Left 1203431285 Un_GL000195v1:93249-93271 CCAGGGGATGCTCAAGGCCCACC No data
Right 1203431292 Un_GL000195v1:93290-93312 GTGTACTGAGATGAGCAAGGAGG No data
1203431285_1203431291 15 Left 1203431285 Un_GL000195v1:93249-93271 CCAGGGGATGCTCAAGGCCCACC No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203431285 Original CRISPR GGTGGGCCTTGAGCATCCCC TGG (reversed) Intergenic