ID: 1203431287

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:93266-93288
Sequence ACAGGTGACTGTGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203431287_1203431294 27 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG No data
1203431287_1203431291 -2 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data
1203431287_1203431293 26 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431293 Un_GL000195v1:93315-93337 CAAGTAGACACAAATCCCCATGG No data
1203431287_1203431292 1 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431292 Un_GL000195v1:93290-93312 GTGTACTGAGATGAGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203431287 Original CRISPR ACAGGTGACTGTGCCGAGGT GGG (reversed) Intergenic
No off target data available for this crispr