ID: 1203431290 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Un_GL000195v1:93284-93306 |
| Sequence | TGCTCATCTCAGTACACTAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203431290_1203431293 | 8 | Left | 1203431290 | Un_GL000195v1:93284-93306 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
| Right | 1203431293 | Un_GL000195v1:93315-93337 | CAAGTAGACACAAATCCCCATGG | No data | ||||
| 1203431290_1203431295 | 14 | Left | 1203431290 | Un_GL000195v1:93284-93306 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
| Right | 1203431295 | Un_GL000195v1:93321-93343 | GACACAAATCCCCATGGGCTTGG | No data | ||||
| 1203431290_1203431294 | 9 | Left | 1203431290 | Un_GL000195v1:93284-93306 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
| Right | 1203431294 | Un_GL000195v1:93316-93338 | AAGTAGACACAAATCCCCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203431290 | Original CRISPR | TGCTCATCTCAGTACACTAC AGG (reversed) | Intergenic | ||