ID: 1203431291

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:93287-93309
Sequence GTAGTGTACTGAGATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203431287_1203431291 -2 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data
1203431288_1203431291 -3 Left 1203431288 Un_GL000195v1:93267-93289 CCACCTCGGCACAGTCACCTGTA No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data
1203431284_1203431291 16 Left 1203431284 Un_GL000195v1:93248-93270 CCCAGGGGATGCTCAAGGCCCAC No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data
1203431289_1203431291 -6 Left 1203431289 Un_GL000195v1:93270-93292 CCTCGGCACAGTCACCTGTAGTG No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data
1203431285_1203431291 15 Left 1203431285 Un_GL000195v1:93249-93271 CCAGGGGATGCTCAAGGCCCACC No data
Right 1203431291 Un_GL000195v1:93287-93309 GTAGTGTACTGAGATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203431291 Original CRISPR GTAGTGTACTGAGATGAGCA AGG Intergenic
No off target data available for this crispr