ID: 1203431294

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:93316-93338
Sequence AAGTAGACACAAATCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203431289_1203431294 23 Left 1203431289 Un_GL000195v1:93270-93292 CCTCGGCACAGTCACCTGTAGTG No data
Right 1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG No data
1203431288_1203431294 26 Left 1203431288 Un_GL000195v1:93267-93289 CCACCTCGGCACAGTCACCTGTA No data
Right 1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG No data
1203431287_1203431294 27 Left 1203431287 Un_GL000195v1:93266-93288 CCCACCTCGGCACAGTCACCTGT No data
Right 1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG No data
1203431290_1203431294 9 Left 1203431290 Un_GL000195v1:93284-93306 CCTGTAGTGTACTGAGATGAGCA No data
Right 1203431294 Un_GL000195v1:93316-93338 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203431294 Original CRISPR AAGTAGACACAAATCCCCAT GGG Intergenic
No off target data available for this crispr