ID: 1203431717

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:95753-95775
Sequence AATGGTGACCTGAGAGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203431717_1203431720 -7 Left 1203431717 Un_GL000195v1:95753-95775 CCCGCAACTCTCAGGTCACCATT No data
Right 1203431720 Un_GL000195v1:95769-95791 CACCATTGGAGAAGATGCTCAGG No data
1203431717_1203431722 27 Left 1203431717 Un_GL000195v1:95753-95775 CCCGCAACTCTCAGGTCACCATT No data
Right 1203431722 Un_GL000195v1:95803-95825 GCTGCAGTCAACCCTGCTGAAGG No data
1203431717_1203431723 30 Left 1203431717 Un_GL000195v1:95753-95775 CCCGCAACTCTCAGGTCACCATT No data
Right 1203431723 Un_GL000195v1:95806-95828 GCAGTCAACCCTGCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203431717 Original CRISPR AATGGTGACCTGAGAGTTGC GGG (reversed) Intergenic
No off target data available for this crispr