ID: 1203434775

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128795-128817
Sequence GCAGTCAACCCTGCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434775_1203434781 29 Left 1203434775 Un_GL000195v1:128795-128817 CCACCTTCAGCAGGGTTGACTGC No data
Right 1203434781 Un_GL000195v1:128847-128869 CAATGGTGACCTGAGAGTTGCGG No data
1203434775_1203434782 30 Left 1203434775 Un_GL000195v1:128795-128817 CCACCTTCAGCAGGGTTGACTGC No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data
1203434775_1203434778 12 Left 1203434775 Un_GL000195v1:128795-128817 CCACCTTCAGCAGGGTTGACTGC No data
Right 1203434778 Un_GL000195v1:128830-128852 TTCCTGAGCATCTTCTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434775 Original CRISPR GCAGTCAACCCTGCTGAAGG TGG (reversed) Intergenic
No off target data available for this crispr