ID: 1203434777

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128822-128844
Sequence GAAGATGCTCAGGAAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434777_1203434781 2 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434781 Un_GL000195v1:128847-128869 CAATGGTGACCTGAGAGTTGCGG No data
1203434777_1203434785 12 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434785 Un_GL000195v1:128857-128879 CTGAGAGTTGCGGGAGGCATTGG No data
1203434777_1203434788 19 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434788 Un_GL000195v1:128864-128886 TTGCGGGAGGCATTGGGGCCAGG No data
1203434777_1203434787 14 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434787 Un_GL000195v1:128859-128881 GAGAGTTGCGGGAGGCATTGGGG No data
1203434777_1203434782 3 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data
1203434777_1203434783 6 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434783 Un_GL000195v1:128851-128873 GGTGACCTGAGAGTTGCGGGAGG No data
1203434777_1203434786 13 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434786 Un_GL000195v1:128858-128880 TGAGAGTTGCGGGAGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434777 Original CRISPR GAAGATGCTCAGGAAGAACA AGG (reversed) Intergenic
No off target data available for this crispr