ID: 1203434779 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Un_GL000195v1:128832-128854 |
Sequence | CACCATTGGAGAAGATGCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 9 Related Crispr Pairs
Show Crispr PairsNote: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1203434779 | Original CRISPR | CACCATTGGAGAAGATGCTC AGG (reversed) | Intergenic | ||
No off target data available for this crispr |