ID: 1203434782

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128848-128870
Sequence AATGGTGACCTGAGAGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434779_1203434782 -7 Left 1203434779 Un_GL000195v1:128832-128854 CCTGAGCATCTTCTCCAATGGTG No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data
1203434775_1203434782 30 Left 1203434775 Un_GL000195v1:128795-128817 CCACCTTCAGCAGGGTTGACTGC No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data
1203434776_1203434782 27 Left 1203434776 Un_GL000195v1:128798-128820 CCTTCAGCAGGGTTGACTGCAGC No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data
1203434777_1203434782 3 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434782 Un_GL000195v1:128848-128870 AATGGTGACCTGAGAGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434782 Original CRISPR AATGGTGACCTGAGAGTTGC GGG Intergenic
No off target data available for this crispr