ID: 1203434785

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128857-128879
Sequence CTGAGAGTTGCGGGAGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434777_1203434785 12 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434785 Un_GL000195v1:128857-128879 CTGAGAGTTGCGGGAGGCATTGG No data
1203434779_1203434785 2 Left 1203434779 Un_GL000195v1:128832-128854 CCTGAGCATCTTCTCCAATGGTG No data
Right 1203434785 Un_GL000195v1:128857-128879 CTGAGAGTTGCGGGAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434785 Original CRISPR CTGAGAGTTGCGGGAGGCAT TGG Intergenic
No off target data available for this crispr