ID: 1203434787

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128859-128881
Sequence GAGAGTTGCGGGAGGCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434780_1203434787 -10 Left 1203434780 Un_GL000195v1:128846-128868 CCAATGGTGACCTGAGAGTTGCG No data
Right 1203434787 Un_GL000195v1:128859-128881 GAGAGTTGCGGGAGGCATTGGGG No data
1203434777_1203434787 14 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434787 Un_GL000195v1:128859-128881 GAGAGTTGCGGGAGGCATTGGGG No data
1203434779_1203434787 4 Left 1203434779 Un_GL000195v1:128832-128854 CCTGAGCATCTTCTCCAATGGTG No data
Right 1203434787 Un_GL000195v1:128859-128881 GAGAGTTGCGGGAGGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434787 Original CRISPR GAGAGTTGCGGGAGGCATTG GGG Intergenic
No off target data available for this crispr