ID: 1203434788

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128864-128886
Sequence TTGCGGGAGGCATTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434777_1203434788 19 Left 1203434777 Un_GL000195v1:128822-128844 CCTTGTTCTTCCTGAGCATCTTC No data
Right 1203434788 Un_GL000195v1:128864-128886 TTGCGGGAGGCATTGGGGCCAGG No data
1203434779_1203434788 9 Left 1203434779 Un_GL000195v1:128832-128854 CCTGAGCATCTTCTCCAATGGTG No data
Right 1203434788 Un_GL000195v1:128864-128886 TTGCGGGAGGCATTGGGGCCAGG No data
1203434780_1203434788 -5 Left 1203434780 Un_GL000195v1:128846-128868 CCAATGGTGACCTGAGAGTTGCG No data
Right 1203434788 Un_GL000195v1:128864-128886 TTGCGGGAGGCATTGGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434788 Original CRISPR TTGCGGGAGGCATTGGGGCC AGG Intergenic
No off target data available for this crispr