ID: 1203434793

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:128893-128915
Sequence CAGAGGAAAAAGGAGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203434780_1203434793 24 Left 1203434780 Un_GL000195v1:128846-128868 CCAATGGTGACCTGAGAGTTGCG No data
Right 1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG No data
1203434784_1203434793 14 Left 1203434784 Un_GL000195v1:128856-128878 CCTGAGAGTTGCGGGAGGCATTG No data
Right 1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203434793 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG Intergenic
No off target data available for this crispr