ID: 1203435221

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131370-131392
Sequence GAGATGCTCAAGGCCCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435221_1203435233 24 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435233 Un_GL000195v1:131417-131439 TGGGCCTGGCCTGGCATTGAGGG No data
1203435221_1203435225 -3 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435225 Un_GL000195v1:131390-131412 CTCCTGGGCTGTGTTAGCAAAGG No data
1203435221_1203435231 15 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435231 Un_GL000195v1:131408-131430 AAAGGGCTCTGGGCCTGGCCTGG No data
1203435221_1203435235 28 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435235 Un_GL000195v1:131421-131443 CCTGGCCTGGCATTGAGGGATGG No data
1203435221_1203435230 10 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435230 Un_GL000195v1:131403-131425 TTAGCAAAGGGCTCTGGGCCTGG No data
1203435221_1203435228 4 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435228 Un_GL000195v1:131397-131419 GCTGTGTTAGCAAAGGGCTCTGG No data
1203435221_1203435229 5 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG No data
1203435221_1203435226 -2 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435226 Un_GL000195v1:131391-131413 TCCTGGGCTGTGTTAGCAAAGGG No data
1203435221_1203435232 23 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435232 Un_GL000195v1:131416-131438 CTGGGCCTGGCCTGGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435221 Original CRISPR GAGATGCTCAAGGCCCACCT CGG (reversed) Intergenic
No off target data available for this crispr