ID: 1203435224

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131380-131402
Sequence CACAGCCCAGGAGATGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435224_1203435230 0 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435230 Un_GL000195v1:131403-131425 TTAGCAAAGGGCTCTGGGCCTGG No data
1203435224_1203435233 14 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435233 Un_GL000195v1:131417-131439 TGGGCCTGGCCTGGCATTGAGGG No data
1203435224_1203435228 -6 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435228 Un_GL000195v1:131397-131419 GCTGTGTTAGCAAAGGGCTCTGG No data
1203435224_1203435237 27 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435237 Un_GL000195v1:131430-131452 GCATTGAGGGATGGCAAATAAGG No data
1203435224_1203435238 28 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435238 Un_GL000195v1:131431-131453 CATTGAGGGATGGCAAATAAGGG No data
1203435224_1203435235 18 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435235 Un_GL000195v1:131421-131443 CCTGGCCTGGCATTGAGGGATGG No data
1203435224_1203435231 5 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435231 Un_GL000195v1:131408-131430 AAAGGGCTCTGGGCCTGGCCTGG No data
1203435224_1203435239 29 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435239 Un_GL000195v1:131432-131454 ATTGAGGGATGGCAAATAAGGGG No data
1203435224_1203435232 13 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435232 Un_GL000195v1:131416-131438 CTGGGCCTGGCCTGGCATTGAGG No data
1203435224_1203435229 -5 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435224 Original CRISPR CACAGCCCAGGAGATGCTCA AGG (reversed) Intergenic
No off target data available for this crispr