ID: 1203435227

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131392-131414
Sequence GCCCTTTGCTAACACAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435227_1203435241 23 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435241 Un_GL000195v1:131438-131460 GGATGGCAAATAAGGGGCCTGGG No data
1203435227_1203435231 -7 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435231 Un_GL000195v1:131408-131430 AAAGGGCTCTGGGCCTGGCCTGG No data
1203435227_1203435235 6 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435235 Un_GL000195v1:131421-131443 CCTGGCCTGGCATTGAGGGATGG No data
1203435227_1203435233 2 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435233 Un_GL000195v1:131417-131439 TGGGCCTGGCCTGGCATTGAGGG No data
1203435227_1203435232 1 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435232 Un_GL000195v1:131416-131438 CTGGGCCTGGCCTGGCATTGAGG No data
1203435227_1203435237 15 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435237 Un_GL000195v1:131430-131452 GCATTGAGGGATGGCAAATAAGG No data
1203435227_1203435240 22 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435240 Un_GL000195v1:131437-131459 GGGATGGCAAATAAGGGGCCTGG No data
1203435227_1203435238 16 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435238 Un_GL000195v1:131431-131453 CATTGAGGGATGGCAAATAAGGG No data
1203435227_1203435242 24 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435242 Un_GL000195v1:131439-131461 GATGGCAAATAAGGGGCCTGGGG No data
1203435227_1203435239 17 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435239 Un_GL000195v1:131432-131454 ATTGAGGGATGGCAAATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435227 Original CRISPR GCCCTTTGCTAACACAGCCC AGG (reversed) Intergenic