ID: 1203435228

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131397-131419
Sequence GCTGTGTTAGCAAAGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435221_1203435228 4 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435228 Un_GL000195v1:131397-131419 GCTGTGTTAGCAAAGGGCTCTGG No data
1203435224_1203435228 -6 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435228 Un_GL000195v1:131397-131419 GCTGTGTTAGCAAAGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435228 Original CRISPR GCTGTGTTAGCAAAGGGCTC TGG Intergenic
No off target data available for this crispr