ID: 1203435229

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131398-131420
Sequence CTGTGTTAGCAAAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435224_1203435229 -5 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG No data
1203435221_1203435229 5 Left 1203435221 Un_GL000195v1:131370-131392 CCGAGGTGGGCCTTGAGCATCTC No data
Right 1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435229 Original CRISPR CTGTGTTAGCAAAGGGCTCT GGG Intergenic
No off target data available for this crispr