ID: 1203435239

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131432-131454
Sequence ATTGAGGGATGGCAAATAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435224_1203435239 29 Left 1203435224 Un_GL000195v1:131380-131402 CCTTGAGCATCTCCTGGGCTGTG No data
Right 1203435239 Un_GL000195v1:131432-131454 ATTGAGGGATGGCAAATAAGGGG No data
1203435227_1203435239 17 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435239 Un_GL000195v1:131432-131454 ATTGAGGGATGGCAAATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435239 Original CRISPR ATTGAGGGATGGCAAATAAG GGG Intergenic