ID: 1203435241

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:131438-131460
Sequence GGATGGCAAATAAGGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203435234_1203435241 -6 Left 1203435234 Un_GL000195v1:131421-131443 CCTGGCCTGGCATTGAGGGATGG No data
Right 1203435241 Un_GL000195v1:131438-131460 GGATGGCAAATAAGGGGCCTGGG No data
1203435227_1203435241 23 Left 1203435227 Un_GL000195v1:131392-131414 CCTGGGCTGTGTTAGCAAAGGGC No data
Right 1203435241 Un_GL000195v1:131438-131460 GGATGGCAAATAAGGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203435241 Original CRISPR GGATGGCAAATAAGGGGCCT GGG Intergenic