ID: 1203436087

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000195v1:138268-138290
Sequence GGCCCTCGCTGCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203436087_1203436098 14 Left 1203436087 Un_GL000195v1:138268-138290 CCGCTGGGCCAGCAGCGAGGGCC No data
Right 1203436098 Un_GL000195v1:138305-138327 GGCCCATCCGGTCCTGTCCCTGG No data
1203436087_1203436099 15 Left 1203436087 Un_GL000195v1:138268-138290 CCGCTGGGCCAGCAGCGAGGGCC No data
Right 1203436099 Un_GL000195v1:138306-138328 GCCCATCCGGTCCTGTCCCTGGG No data
1203436087_1203436089 -7 Left 1203436087 Un_GL000195v1:138268-138290 CCGCTGGGCCAGCAGCGAGGGCC No data
Right 1203436089 Un_GL000195v1:138284-138306 GAGGGCCCCCACGTCCCGTCCGG No data
1203436087_1203436094 2 Left 1203436087 Un_GL000195v1:138268-138290 CCGCTGGGCCAGCAGCGAGGGCC No data
Right 1203436094 Un_GL000195v1:138293-138315 CACGTCCCGTCCGGCCCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203436087 Original CRISPR GGCCCTCGCTGCTGGCCCAG CGG (reversed) Intergenic