ID: 1203445593

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:52219-52241
Sequence CAGGGAATACAGATTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203445593_1203445596 15 Left 1203445593 Un_GL000219v1:52219-52241 CCATGCACAATCTGTATTCCCTG No data
Right 1203445596 Un_GL000219v1:52257-52279 AAATCTAATTCTCACTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203445593 Original CRISPR CAGGGAATACAGATTGTGCA TGG (reversed) Intergenic
No off target data available for this crispr