ID: 1203446753

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:63862-63884
Sequence AAGTCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203446753_1203446757 18 Left 1203446753 Un_GL000219v1:63862-63884 CCTTCACTCTTCTAGAAGGACTT No data
Right 1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1203446753_1203446755 2 Left 1203446753 Un_GL000219v1:63862-63884 CCTTCACTCTTCTAGAAGGACTT No data
Right 1203446755 Un_GL000219v1:63887-63909 TTTGATAGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203446753 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr