ID: 1203446755

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:63887-63909
Sequence TTTGATAGGTCCTTTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203446753_1203446755 2 Left 1203446753 Un_GL000219v1:63862-63884 CCTTCACTCTTCTAGAAGGACTT No data
Right 1203446755 Un_GL000219v1:63887-63909 TTTGATAGGTCCTTTTTCCATGG No data
1203446750_1203446755 10 Left 1203446750 Un_GL000219v1:63854-63876 CCAGGAGCCCTTCACTCTTCTAG No data
Right 1203446755 Un_GL000219v1:63887-63909 TTTGATAGGTCCTTTTTCCATGG No data
1203446752_1203446755 3 Left 1203446752 Un_GL000219v1:63861-63883 CCCTTCACTCTTCTAGAAGGACT No data
Right 1203446755 Un_GL000219v1:63887-63909 TTTGATAGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203446755 Original CRISPR TTTGATAGGTCCTTTTTCCA TGG Intergenic
No off target data available for this crispr