ID: 1203446757

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:63903-63925
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 17, 1: 21, 2: 24, 3: 47, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203446752_1203446757 19 Left 1203446752 Un_GL000219v1:63861-63883 CCCTTCACTCTTCTAGAAGGACT No data
Right 1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1203446753_1203446757 18 Left 1203446753 Un_GL000219v1:63862-63884 CCTTCACTCTTCTAGAAGGACTT No data
Right 1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1203446750_1203446757 26 Left 1203446750 Un_GL000219v1:63854-63876 CCAGGAGCCCTTCACTCTTCTAG No data
Right 1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203446757 Original CRISPR TCCATGGTTTAGAATAAAAG AGG Intergenic
904877602 1:33668418-33668440 TCAAAGGTTTATAATAAAAGGGG - Intronic
904913572 1:33953564-33953586 TCCATGGGCTAGAATCCAAGTGG + Intronic
905552050 1:38849829-38849851 TCCATTGTTTAAATTAGAAGTGG + Intronic
906071925 1:43023112-43023134 TCCATATTTTATAATAAATGCGG + Intergenic
906133932 1:43481945-43481967 TCCATTGATTAAAATAAAAAAGG - Intergenic
906421569 1:45672637-45672659 TCCATGGATTTAAATAAAATTGG - Intronic
907211825 1:52830293-52830315 TCCATGGTTTAGAATAAAAGAGG - Intergenic
908732633 1:67242109-67242131 TCCATAGTTTGAAGTAAAAGAGG - Intronic
908934539 1:69358544-69358566 TCCATGATTTGGAATAAAAGAGG - Intergenic
909209973 1:72810659-72810681 TCCATGGTTTAGAATAAAAGAGG - Intergenic
909576130 1:77178336-77178358 TCCATGGTTTGGAGTAAAAACGG + Intronic
910179759 1:84469390-84469412 TCTAGGCTTTAGAATAAAAAAGG + Intergenic
911539525 1:99141729-99141751 TCCTTGGTTGAGAATAAATCTGG - Intergenic
912184100 1:107253698-107253720 CAAATGGTTTAAAATAAAAGAGG - Intronic
912232354 1:107809734-107809756 TCTAAGGTATAGAATAAAATGGG - Intronic
912897554 1:113608897-113608919 TCCACTTTTGAGAATAAAAGGGG - Intronic
913084490 1:115424241-115424263 TCCATGGTTGGGATCAAAAGAGG + Intergenic
913522463 1:119658223-119658245 TCCATGGTTCATAATATATGAGG - Intergenic
916035197 1:160915828-160915850 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
916768223 1:167882549-167882571 GCCATGGATGAAAATAAAAGGGG + Intronic
918873262 1:190005048-190005070 TCTTTGGTTTAGCACAAAAGAGG + Intergenic
919210297 1:194474299-194474321 TCCATGGTGAAGAATAAATAAGG + Intergenic
919328844 1:196143191-196143213 TCCATTTATTTGAATAAAAGTGG + Intergenic
920157268 1:203964281-203964303 TCCATGGTTTGGAATAAAAGAGG - Intergenic
921555249 1:216591066-216591088 TCAATTCTTTAGAAAAAAAGAGG - Intronic
921779173 1:219141287-219141309 TCCATGGTTTATACTGGAAGAGG - Intergenic
921953551 1:220958494-220958516 TCCAAGGCTTAGAACCAAAGAGG - Intergenic
922158344 1:223058284-223058306 TCCATGTTTTTGAATAAAAGAGG - Intergenic
922759015 1:228113517-228113539 TCCATCGTTTAGAATAAAATAGG - Intergenic
923963803 1:239113307-239113329 TACATGCTTTATAATAAAACAGG - Intergenic
924121179 1:240799787-240799809 CACATGGTTTAGAATAGAGGTGG + Intronic
1063228090 10:4034773-4034795 TCCAAGTTTTTGAATTAAAGGGG - Intergenic
1063806832 10:9654284-9654306 GCCATTGTTTATAATAAAACAGG + Intergenic
1065807213 10:29405283-29405305 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1066784026 10:38982140-38982162 TCAATGAATAAGAATAAAAGTGG + Intergenic
1067422063 10:46160538-46160560 TCCATAGTTTGGAATAAAAGCGG + Intergenic
1067507370 10:46866627-46866649 TCCATAGTTTGGAATAAAAGCGG + Intergenic
1067680837 10:48439428-48439450 TCCGTGGATTGGGATAAAAGGGG + Intergenic
1068006913 10:51402038-51402060 TTCATAGTTTAGAAAAAGAGTGG - Intronic
1068706041 10:60076574-60076596 TGCATGATTTAGAATGGAAGAGG + Intronic
1069260981 10:66396334-66396356 TCCATGTATTAGGATAAAACTGG - Intronic
1071673154 10:87630409-87630431 TCCATGGTTTAAAGTAAATGAGG + Intergenic
1074833732 10:117268722-117268744 TCCAAGGTGGAGAATAATAGGGG + Intronic
1077312779 11:1898558-1898580 TCCATGGTTTGGAGTAAATGAGG - Intergenic
1078311815 11:10251301-10251323 TCCATGATTTAGAATAAAAGAGG + Intronic
1078868084 11:15317025-15317047 TCCATGGTATCAAATAAATGTGG + Intergenic
1079151782 11:17906321-17906343 TCCATGGTTTAGAATACCAGTGG + Intronic
1079754938 11:24245647-24245669 TGAATGTTTGAGAATAAAAGGGG + Intergenic
1080375985 11:31711996-31712018 CCCATGGTTTAGAAGAAATTGGG - Intronic
1080810000 11:35694258-35694280 TCCATGATTTGGAATAAAAAAGG - Intronic
1082698360 11:56398682-56398704 TCCATGGTTTAGAATAAAAAAGG - Intergenic
1086590857 11:88511908-88511930 TCCATGCTTTGTATTAAAAGGGG - Intronic
1087226899 11:95611381-95611403 TTCATGGTTTAGAATAAAATAGG - Intergenic
1087524699 11:99295476-99295498 TCCATGGTTTAGAATAAAAGTGG - Intronic
1088143227 11:106643734-106643756 TCCATGGCTTGGAGTAAATGAGG + Intergenic
1089028572 11:115297982-115298004 TGCATAGTTTAAAATAAGAGTGG + Intronic
1089154257 11:116388506-116388528 ACCTTGTTTTAGACTAAAAGTGG - Intergenic
1090292890 11:125561371-125561393 TCGACGGTTTGGAGTAAAAGAGG + Intergenic
1091136489 11:133195265-133195287 TCTATGGATTAGAATAATGGTGG - Intronic
1091687107 12:2570960-2570982 TCCTTGGTTTACAGTGAAAGTGG + Intronic
1092733514 12:11557222-11557244 TCTATGAATTAGAATAAAAAAGG - Intergenic
1094239586 12:28206845-28206867 TCCACGGTTTGGAATAAAAGAGG - Intronic
1094579954 12:31725599-31725621 GCCATGGTTAAGTTTAAAAGAGG - Intronic
1095878793 12:47109932-47109954 AACATGGTTTAGAATCATAGAGG - Intronic
1097254582 12:57663951-57663973 TCCATGGTTTAGAATAAGAGAGG + Intergenic
1098231671 12:68377570-68377592 TCTATGGTTCAGAATGCAAGTGG + Intergenic
1098294422 12:68990029-68990051 TCCATGATTTGGAATAAAAGAGG + Intergenic
1098502568 12:71210546-71210568 TCCATGGTTTAAAATAAAAGAGG + Intronic
1098503115 12:71217315-71217337 TCCATGGATAACAATAAAGGAGG - Intronic
1098655762 12:73027525-73027547 TCCATGGTTATGAAAACAAGTGG + Intergenic
1099837466 12:87925006-87925028 TAAATGGTGTAGAATAAAAAGGG + Intergenic
1100487216 12:95041929-95041951 TCCATGCTATAGAATATATGTGG + Intronic
1101189413 12:102315902-102315924 TCCATGGTTTAGAATACAAGAGG + Intergenic
1103159129 12:118713053-118713075 TCCCTGGGATAGAATTAAAGGGG - Intergenic
1106621279 13:31373343-31373365 TACATATTTTAGACTAAAAGGGG + Intergenic
1107309842 13:39064821-39064843 TCCATGTTGTAGAATATAACAGG + Intergenic
1108741790 13:53346124-53346146 TGCCTGGTTTATAGTAAAAGTGG - Intergenic
1109970600 13:69763061-69763083 TCCATGATTTGGAATAAATGAGG + Intronic
1110050162 13:70886959-70886981 TCCATGGTTTACAATAAAAGAGG + Intergenic
1110200885 13:72848964-72848986 TGCACTTTTTAGAATAAAAGAGG - Intronic
1110472035 13:75871104-75871126 ACCATGGGTTAAAATGAAAGAGG + Exonic
1111156638 13:84336677-84336699 TCCGTGATTTAGAATGAAAATGG + Intergenic
1113968449 13:114168807-114168829 TCCATTGTTTGGAGTAAAAGAGG - Intergenic
1114997884 14:28380411-28380433 TCCATGCTGTAGCATACAAGAGG - Intergenic
1115533396 14:34347342-34347364 TCCATAGTTTGGAGTAAATGAGG - Intronic
1115824734 14:37256404-37256426 TCCATGAATTATTATAAAAGTGG + Intronic
1115907844 14:38221151-38221173 CCCATGGTTTGGAGTAAATGAGG - Intergenic
1116110971 14:40580756-40580778 TGAATGGTTTTGAATAAAATTGG - Intergenic
1116576583 14:46583014-46583036 TCTGTGGTTTAAAGTAAAAGAGG - Intergenic
1116676888 14:47918086-47918108 GAAATGGTTTAGAAGAAAAGAGG + Intergenic
1116679311 14:47945596-47945618 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1116725620 14:48558350-48558372 TCCATGGTTTAAAGTAAAAGAGG - Intergenic
1116970790 14:51062978-51063000 TCCATAGTTTAAAAGAAAAAAGG + Intronic
1118536842 14:66776289-66776311 TCCATGTATTAGTTTAAAAGAGG - Intronic
1119029008 14:71176836-71176858 TCCATTGTTTAGACTGAAACAGG - Intergenic
1120649797 14:87118480-87118502 TCCATGGTTTGGAGTAAATGAGG + Intergenic
1122193157 14:100064266-100064288 TTTATGGTTTAGAAAAGAAGAGG - Intronic
1124039664 15:26089311-26089333 TCCATGGTTTCGAGTAAAAAAGG - Intergenic
1124260326 15:28183786-28183808 TTCATGTTTTGGAATAAAAGTGG + Intronic
1126349067 15:47725667-47725689 TCCATGGTTAAGTTTAATAGTGG + Intronic
1127717153 15:61660126-61660148 CCCATGGTTGAGAATGTAAGGGG - Intergenic
1133077374 16:3290182-3290204 TCCATGGTTTGTAAGAAAGGGGG - Exonic
1134382965 16:13745397-13745419 GCCATGGTAAAGAATAAAAAAGG - Intergenic
1135185123 16:20309166-20309188 TCCCTTCTGTAGAATAAAAGGGG - Intergenic
1135811916 16:25595221-25595243 TGCATACTTTAGAATAAAACTGG - Intergenic
1137927422 16:52553804-52553826 TCTAAGGTTTAGACTAATAGAGG - Intergenic
1144691693 17:17270298-17270320 ACAATGGCTCAGAATAAAAGAGG + Intronic
1146420012 17:32675169-32675191 TGCATGGTTTATCATAACAGTGG + Intronic
1147463878 17:40595183-40595205 TTCTTGGTTTAGAGTAAATGAGG + Intergenic
1148832051 17:50440153-50440175 TCCATGGCTTGGAACAAAACAGG + Intronic
1148981770 17:51582949-51582971 TCCATGTTTTTGAAAATAAGAGG + Intergenic
1151529183 17:74693486-74693508 TCCATGGCAGAGAATGAAAGAGG + Intronic
1153118166 18:1686475-1686497 TTCATCGTTTGGAGTAAAAGAGG - Intergenic
1154365687 18:13706622-13706644 TTCACGGTTTGGAATAAAAGAGG + Intronic
1157427020 18:47592872-47592894 GCCATGAAATAGAATAAAAGGGG + Intergenic
1157527931 18:48399314-48399336 TCCATGGTTTAAAATTCAAAAGG - Intronic
1158026840 18:52908676-52908698 TCCATGGTTTACAATGCAAATGG - Intronic
1159288214 18:66380395-66380417 TGCCTGTTTTAGAAAAAAAGAGG + Intergenic
1162780713 19:13005825-13005847 TCCAAGGCTCAGAATAAAGGTGG + Intronic
1163992833 19:21015065-21015087 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1164071396 19:21772071-21772093 CCCATGGTTTAGAGTAAATGAGG - Intergenic
1164212612 19:23112935-23112957 CCCCTGGTTTAGAGTAAATGAGG + Intronic
1164245426 19:23424279-23424301 TCCATGGTATAAAGTAAATGAGG + Intergenic
1164308639 19:24027258-24027280 TCCATGGCGTAGAGTAAATGAGG - Intergenic
1164537947 19:29100369-29100391 TCCATCCTTTTGAAGAAAAGGGG + Intergenic
1165722204 19:38087625-38087647 AGCATGTTTTAGAAAAAAAGAGG + Intronic
1165994870 19:39836861-39836883 ACCATGGTTTACAAGAAGAGTGG - Intronic
1168614034 19:57823363-57823385 TCCATGGTTTACAATAGCAGTGG - Intronic
1168618052 19:57854368-57854390 TCCATGGTTTACAATAGCAGTGG - Intronic
1168625293 19:57913280-57913302 TCCATGGTTTACAATAGCAGTGG + Intronic
926405210 2:12544715-12544737 TCCTTGGTTATGAAGAAAAGAGG + Intergenic
928015403 2:27651818-27651840 TCCTTTGTTTATAATGAAAGTGG - Exonic
928051428 2:28000560-28000582 TCCATAGTAAAGGATAAAAGGGG - Intronic
928241886 2:29593462-29593484 TACAGGGTATAGAATGAAAGGGG - Intronic
928997873 2:37314714-37314736 TCTATGGTTTCAAATAAAAAGGG + Intronic
929246025 2:39704499-39704521 TCCTTGGTTTACAAGACAAGGGG - Intronic
929308079 2:40388667-40388689 TCCAAGCTTCTGAATAAAAGAGG - Intronic
929496681 2:42450902-42450924 TCCATTGTTAAGATTAAATGGGG + Intronic
930511894 2:52356559-52356581 AACATGCTTTAGAATCAAAGGGG + Intergenic
931084033 2:58808966-58808988 TCCTTTCTTTAGAATTAAAGAGG + Intergenic
931589815 2:63870588-63870610 TCCTTAGTTTAAAATAAAAGTGG - Intronic
931980164 2:67685942-67685964 TCCATGTTTGAGAGTGAAAGGGG + Intergenic
932908937 2:75785084-75785106 TTTTTGGTTTAGAAAAAAAGTGG - Intergenic
933077736 2:77950861-77950883 TCCATGGTTTAAAGTAGAAGAGG - Intergenic
933576772 2:84078379-84078401 TCCATGTGATAGAATAAAACAGG + Intergenic
934013810 2:87855994-87856016 TCCATTGTTTGGAATTAATGTGG + Intergenic
934785448 2:97001947-97001969 TACATGGTTTAAAAAAAAAAAGG - Intronic
935823956 2:106923212-106923234 TACATGCTAAAGAATAAAAGTGG - Intergenic
936438510 2:112529420-112529442 TGCATGTTTTAGAAACAAAGTGG + Exonic
937031858 2:118747476-118747498 TCCAAGTGTTAGAATGAAAGAGG - Intergenic
937601185 2:123735539-123735561 TAGATTGTTTAGAGTAAAAGAGG - Intergenic
938051562 2:128177370-128177392 TCCATTGTTGAGAAGAAAAATGG + Intronic
942130124 2:172870195-172870217 ACTATGGGTTACAATAAAAGAGG - Intronic
942394759 2:175535544-175535566 TCCATTGCTTATAATCAAAGGGG + Intergenic
942929140 2:181468939-181468961 TACATGGTTTAACATAAAAGAGG - Intronic
943969133 2:194380785-194380807 TCCATCGTTTGGAGTAAAAGAGG - Intergenic
944014839 2:195022936-195022958 AGCATTATTTAGAATAAAAGAGG + Intergenic
944654379 2:201863439-201863461 TCCAAGTTGAAGAATAAAAGAGG + Intronic
946296845 2:218791159-218791181 TCCATGGTTTGGAGTAAATGAGG - Intronic
947543870 2:230996862-230996884 TATATGGTTTAGAATAAGGGAGG + Intronic
1169040994 20:2495293-2495315 TCTAGTGATTAGAATAAAAGAGG + Intronic
1169247850 20:4037947-4037969 TCCAGGGTTCAGAATAAAAGGGG + Intergenic
1170229543 20:14029465-14029487 TCCATAGTTTAGAAAAAGAAAGG + Intronic
1171318499 20:24217879-24217901 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
1171721766 20:28570341-28570363 TCCATGGTTTAGAATATAAGAGG + Intergenic
1171756296 20:29113158-29113180 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1171785957 20:29464735-29464757 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1171862283 20:30412237-30412259 TCCATGGTTTAGAATAAAGGAGG - Intergenic
1173490778 20:43479405-43479427 TCTATGGTTTGGAGTAAATGAGG - Intergenic
1174856797 20:54053400-54053422 TTCATGTTTTAGTTTAAAAGAGG + Intronic
1177769761 21:25501444-25501466 TACATGGTTTACAGTTAAAGGGG - Intergenic
1178220259 21:30648920-30648942 AGAATGGTTTAGATTAAAAGAGG + Intergenic
1178477707 21:32951859-32951881 AACATGTTTTAAAATAAAAGTGG - Intergenic
1178735990 21:35151671-35151693 TCCATGCTTTAGATTAAGACAGG + Intronic
1180295321 22:10929028-10929050 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1180413350 22:12637016-12637038 TCCATGGTTTAGAATAAAAGAGG - Intergenic
1180727204 22:17955236-17955258 TCCCTGGTTTAGGGTAGAAGAGG + Intronic
1181453728 22:23041371-23041393 TCCATGGTTTGGAGTAAATGAGG - Intergenic
1181868922 22:25882433-25882455 TCCATGGATTCTCATAAAAGGGG + Intronic
1183643426 22:39107392-39107414 TCCATAGTTTAGAATAAAAGTGG + Intergenic
1184618704 22:45656666-45656688 TGCATGGTTTGGAGTAAATGAGG + Intergenic
950604776 3:14068891-14068913 TCCATGGTTTAGAATAAAAGAGG - Intronic
951250340 3:20386994-20387016 TCCATGGTTTAGAATAAAAGAGG + Intergenic
952964065 3:38610329-38610351 TCCATGGACTACATTAAAAGGGG - Intronic
952982038 3:38744043-38744065 TCCATTGTTTATAATAATAATGG + Intronic
954032878 3:47832575-47832597 TCCATGGTTGAGAATCACTGAGG - Intronic
955016496 3:55075969-55075991 TCCATCGTTTAGAATGAGACTGG - Intergenic
955046368 3:55364329-55364351 TGCATGGAATGGAATAAAAGGGG - Intergenic
955535912 3:59923628-59923650 CCCACGGTTTGTAATAAAAGTGG - Intronic
955660372 3:61292553-61292575 TCCTTGGTTTAGAAAGAAATAGG + Intergenic
955912403 3:63870857-63870879 TCCAGGGGTTAGAACACAAGAGG - Intronic
956435592 3:69231850-69231872 TCCATAGTTTAGGATCAAACGGG + Intronic
957603442 3:82368549-82368571 TCCATGGTTTAGAATAAAAGAGG - Intergenic
957724802 3:84050042-84050064 TCCATAGTTTAGTATAAAAGAGG + Intergenic
957750869 3:84413574-84413596 TCCATGGATTGGAATAAAGGAGG + Intergenic
959546006 3:107597714-107597736 TTCTTTGTTTAGAATAAAATTGG - Intronic
959827256 3:110813245-110813267 GCCATGTTTTAAAACAAAAGGGG + Intergenic
959852795 3:111109531-111109553 TTCAGTGTTTAGTATAAAAGAGG + Intronic
961596269 3:128020242-128020264 TCCATGGTTTGGAATAAAAGAGG + Intergenic
962246082 3:133794953-133794975 TCCATGATTTGGAATAAAAGAGG + Intronic
963444260 3:145383424-145383446 TCCATGGGTTAGAAAACAAAGGG + Intergenic
963856973 3:150264563-150264585 TCCCTGGTTAAAATTAAAAGTGG + Intergenic
964152704 3:153547240-153547262 TCAATGGTTTACCATAAAAAAGG + Intergenic
965278678 3:166720645-166720667 TCCATGATTTGGAGTAAAAGAGG - Intergenic
966137506 3:176716003-176716025 TCCATGGTACAGAATATAATAGG - Intergenic
966536203 3:181037111-181037133 TTCATGGTTCAGAATAAAAGAGG - Intergenic
966670114 3:182517036-182517058 TTTATGGTTAAGAATAAAAGCGG - Intergenic
967783426 3:193464746-193464768 TCCAAGGTTTAGAGGAGAAGTGG - Intronic
968846956 4:3048803-3048825 TCCATGGTTTAGAGTAAAAGAGG - Intergenic
970041304 4:11799897-11799919 ATCATTATTTAGAATAAAAGTGG - Intergenic
970429662 4:15977088-15977110 GCCATGGTTGTGAAAAAAAGGGG - Intronic
970509831 4:16770749-16770771 TCCATGTTTGAGTATAAAATAGG - Intronic
970723479 4:19015555-19015577 TCCTTGATTTAGAAGGAAAGAGG + Intergenic
970833179 4:20367478-20367500 TAAATGGTTTAAAATAAATGAGG - Intronic
970937428 4:21590080-21590102 TTGATGTTTTAGTATAAAAGTGG + Intronic
971034857 4:22682118-22682140 TGAATGCTTTAGAATAGAAGGGG + Intergenic
971423149 4:26492058-26492080 TTCATGGTTTCAAAGAAAAGAGG - Intergenic
971719651 4:30229266-30229288 TCCATGGTTTGGAATAAAAGAGG - Intergenic
971897249 4:32613760-32613782 AGCATGATTTAAAATAAAAGAGG + Intergenic
972664117 4:41147364-41147386 ACCAAGGTTTTGAATAAAAAAGG - Intronic
972931263 4:44073487-44073509 TCCATCGCTTATAATAAATGAGG + Intergenic
973035300 4:45398123-45398145 TCCATGGTTTGGAGTAAATGAGG - Intergenic
973216037 4:47670541-47670563 TCCTTGGTGTTGAATAAGAGGGG + Intronic
973813869 4:54600209-54600231 TCCATGGTTTAGAATAAAATAGG - Intergenic
974967867 4:68785690-68785712 TCCATGGTTTAAAATGACATAGG + Intergenic
975066659 4:70074770-70074792 CCTATGGCTTAGAATGAAAGTGG - Intergenic
975499535 4:75069545-75069567 GCCATGGTGTAGCATGAAAGTGG + Intergenic
976589741 4:86837153-86837175 TCCCTGGTTTAGAGCAAAGGAGG - Intronic
977342795 4:95780743-95780765 ACCATGTTTTAGAATAGATGTGG - Intergenic
978966114 4:114743801-114743823 TCCATGGTTTATAGTAAATGAGG + Intergenic
979463510 4:121009736-121009758 GTAATGCTTTAGAATAAAAGAGG - Intergenic
980777632 4:137457518-137457540 TCCATGGTATATAATAAAACTGG - Intergenic
981201308 4:141982847-141982869 TCCATAGTTTAGAGTAAAAGAGG + Intergenic
983510856 4:168608235-168608257 TCCATGCTTTATAACTAAAGTGG + Intronic
983731541 4:171000048-171000070 GCCATGATATAGAATAAAAGTGG - Intergenic
984208680 4:176818506-176818528 TTGATGCTTTAGAAAAAAAGGGG + Intergenic
984744999 4:183206481-183206503 TACATGTTTTAAAATAAAAGTGG - Intronic
985083646 4:186291876-186291898 TGCATGGCTTAAAATGAAAGGGG - Intergenic
987292824 5:16524447-16524469 TCCAAGGTTTAAAATAGAAAGGG + Intronic
988505669 5:31820353-31820375 TCCATGTTTTTACATAAAAGTGG + Intronic
989093653 5:37760296-37760318 TTCATGGTTTGGAGTAAATGGGG - Intergenic
989426431 5:41301150-41301172 TCAATGGTTTATATAAAAAGAGG - Intergenic
989598922 5:43183700-43183722 TCCATAGTTTAGAGTAAAAAAGG - Intronic
990082007 5:51928521-51928543 TCCATGGTTTGGAATAAAAGAGG + Intergenic
993248794 5:85487685-85487707 TCCATGGTTTGGAATAAAAGAGG + Intergenic
994467659 5:100159002-100159024 TTCATTGTTTGGAGTAAAAGAGG - Intergenic
994702098 5:103147470-103147492 TCTAAGGTATATAATAAAAGTGG - Intronic
994954648 5:106512089-106512111 TACATGTTTAAGAATAAAACAGG + Intergenic
1000457325 5:161466866-161466888 GCCATGCTTTAAAAGAAAAGAGG - Intronic
1001041338 5:168337765-168337787 GCCATGGTGGAGAATAAATGAGG + Intronic
1001218724 5:169880534-169880556 TCCATGGCATAGTAGAAAAGTGG - Intronic
1003926980 6:10885796-10885818 TCCTTGGTTTAGATTAAAATAGG + Intronic
1004765937 6:18726815-18726837 TCTATGGTATGGAATTAAAGAGG + Intergenic
1005133254 6:22536892-22536914 TCCATTGTTTGAATTAAAAGGGG + Intergenic
1006819795 6:36883758-36883780 TCCATGGTTTAGAATAAAAGAGG + Intronic
1008130674 6:47717361-47717383 TCCAGGGCTGAGACTAAAAGGGG - Intronic
1011153251 6:84299119-84299141 TCCATGGATTGGAGTAAATGAGG + Intergenic
1011287066 6:85736185-85736207 TCCATGACTTATAATGAAAGAGG + Intergenic
1011341870 6:86324868-86324890 TCCATAGTTTGGAGTAAAAGAGG + Intergenic
1011510478 6:88094819-88094841 TCCAAGGTCAGGAATAAAAGAGG - Intergenic
1013598259 6:111680518-111680540 TCCATGTTTTAAAAGACAAGGGG - Intronic
1014162939 6:118191047-118191069 TCCATGGTTTGGAATAAAAGAGG - Intronic
1014241662 6:119024815-119024837 TGCATGGTTTTGAATAAGAAGGG + Intronic
1014947208 6:127513662-127513684 TCTAGGGTTTGGAAGAAAAGTGG + Intronic
1015759792 6:136646057-136646079 TCAATTTTTTAAAATAAAAGTGG - Intronic
1016006652 6:139095646-139095668 TCAATGCTTTAGAATCAAAGGGG - Intergenic
1016348215 6:143139153-143139175 TTCATGGTTTATAAAACAAGTGG + Intronic
1018884945 6:167927473-167927495 TGCAGGATTTAGAACAAAAGAGG + Intronic
1019270795 7:147236-147258 TCCATGGTTTGGAATTAAAAAGG - Intergenic
1020286865 7:6688852-6688874 TCCATGTATTAGAAAAAAGGAGG + Exonic
1020727495 7:11833545-11833567 TGCATGCATTAGATTAAAAGCGG + Intergenic
1020910279 7:14120805-14120827 GCCATGGTGTAGATTAAAAACGG + Intergenic
1022744776 7:33160208-33160230 TCCATGGTTTGAAGTAAATGAGG - Intronic
1023267506 7:38422951-38422973 TTAATGATTTAAAATAAAAGGGG - Intronic
1024746626 7:52414241-52414263 TCTGAGGTTTAGAATAAAATGGG + Intergenic
1024997346 7:55282414-55282436 TTCATGGTTTAGAGTAAAAGAGG - Intergenic
1025864617 7:65369312-65369334 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1028400586 7:90421211-90421233 TCCTTGGTTGGGAATAAAAGAGG + Intronic
1028664851 7:93330020-93330042 TCTATGGTTTATAAAGAAAGTGG - Intronic
1028874849 7:95809868-95809890 GCCATGGTTTAAAATAAACTGGG - Intronic
1029810793 7:103046380-103046402 TCCATGGTTTAGAATAAAAGAGG - Intronic
1030180868 7:106707713-106707735 TCCATTGTTGAGAATAAAACAGG - Intergenic
1031305391 7:120119705-120119727 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1031658806 7:124394876-124394898 ACCATAATTTAGAATAAAATAGG - Intergenic
1031742509 7:125452642-125452664 TCCATGATTTAGAATAAAAGAGG - Intergenic
1032146673 7:129388989-129389011 TCCATGGTTTGGAATTTTAGAGG + Intronic
1033850003 7:145483397-145483419 TCCATGGTTTAAAGTAAAAGAGG - Intergenic
1034142655 7:148836701-148836723 TCAATGGTTTAAAAAAAAAGGGG + Intronic
1036157162 8:6353030-6353052 TTCAGTGTTTAGAATAACAGGGG - Intergenic
1038593345 8:28861670-28861692 TCCATAATTTAGAATTAAGGAGG - Intronic
1039168111 8:34709321-34709343 TGCATGGATTAGACAAAAAGAGG - Intergenic
1039370608 8:36980544-36980566 TTCATGGATAAGAATGAAAGAGG - Intergenic
1040089387 8:43381431-43381453 TCCATGGTTTGAAGTACAAGAGG - Intergenic
1040402726 8:47068517-47068539 CCCATGGTTTAAAGTAAAAGAGG + Intergenic
1041425646 8:57717488-57717510 TCTCTGTTTTAGTATAAAAGTGG + Intergenic
1041566647 8:59286138-59286160 TCCATGACTTGGAAAAAAAGAGG - Intergenic
1042355389 8:67822412-67822434 TTCATTGTTTTGAACAAAAGTGG - Intergenic
1042666391 8:71211206-71211228 TCAAAGGTTTGGAAGAAAAGTGG - Exonic
1043097873 8:75998589-75998611 ACAAGGGGTTAGAATAAAAGTGG + Intergenic
1043137334 8:76544683-76544705 TCCATGGCTTGGAGTAAATGAGG + Intergenic
1044018839 8:87079017-87079039 TCCTGGGTCTAGAAAAAAAGGGG - Intronic
1045231902 8:100313857-100313879 TGCATGGAATGGAATAAAAGTGG + Intronic
1045255420 8:100516250-100516272 TCCATAGTTTAGAATAATATCGG + Intronic
1046202577 8:110946817-110946839 TCCATGGTTTGGAATAAAAGGGG - Intergenic
1046254318 8:111676095-111676117 TCCGTGGGTTAGAGTAAATGAGG + Intergenic
1046325572 8:112640418-112640440 TCCATTGTTTTAAAAAAAAGGGG + Intronic
1046391766 8:113582485-113582507 TGCATGGTATATAATAAAACAGG + Intergenic
1046579370 8:116072642-116072664 TCCAAAGTTTGGAATAACAGAGG + Intergenic
1047367423 8:124224140-124224162 TACATGGTTTTGAATAAGATTGG - Intergenic
1049275391 8:141717668-141717690 TCCCTGGCTAAGAATGAAAGGGG - Intergenic
1049306014 8:141904629-141904651 TGCTTGGTTTATAATACAAGTGG - Intergenic
1050401236 9:5257952-5257974 TCTGTGGTTTCGAATAAAAGAGG - Intergenic
1050658089 9:7851565-7851587 TCCATGGTTTAGAATAAAACAGG + Intronic
1051315909 9:15831573-15831595 TCAATGCTTTAGAAGAAAAATGG + Intronic
1051316931 9:15847438-15847460 TACCTGGTTTAAAATAAAAAAGG - Intronic
1052075753 9:24137874-24137896 TCCAGGGTTATGAATAAAAGAGG + Intergenic
1052178593 9:25496924-25496946 TCAAGAGTTTAGAATAAAAGAGG + Intergenic
1052322432 9:27182705-27182727 CCTATGGTTCAGAATAAAATTGG + Intronic
1052764330 9:32625426-32625448 TACGAAGTTTAGAATAAAAGAGG - Intergenic
1055099239 9:72446160-72446182 TTCATTGTTCAGAGTAAAAGGGG + Intergenic
1055178310 9:73349282-73349304 TCCATGATTTAAAAAAAAAAAGG + Intergenic
1055564717 9:77556761-77556783 ACCATGATTAAGAAGAAAAGGGG - Intronic
1056430311 9:86520937-86520959 TCCACGGTTTGGAATAAAAGAGG + Intergenic
1056582062 9:87896204-87896226 TCCATGGTAAAGAAAATAAGTGG - Intergenic
1057217984 9:93240031-93240053 TCCAAGGATGAGAACAAAAGTGG + Intronic
1057781144 9:98051561-98051583 TCTATGGTTTGGAGTAAAAGGGG - Intergenic
1058098612 9:100892199-100892221 GCCATGGTTTGGAGTAAATGAGG + Intergenic
1060616706 9:125023148-125023170 TCGATGTTTTAGAATACAAGGGG + Intronic
1202802198 9_KI270720v1_random:10132-10154 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1203446757 Un_GL000219v1:63903-63925 TCCATGGTTTAGAATAAAAGAGG + Intergenic
1186893400 X:13982413-13982435 TCCATGGTTTGGAATAAAAGAGG + Intergenic
1187297443 X:18015555-18015577 TACATGTTTTATAATGAAAGAGG - Intergenic
1187609080 X:20920805-20920827 TGCATGGTTGAGAATTACAGTGG - Intergenic
1188057348 X:25556678-25556700 TTCAAGGGGTAGAATAAAAGAGG - Intergenic
1188383442 X:29527164-29527186 TAAATGGTTTCGTATAAAAGAGG + Intronic
1188450543 X:30303728-30303750 TCTATGGATTATAATTAAAGGGG + Intergenic
1188544109 X:31284097-31284119 TCAATGCTTTAGTATAAAATAGG - Intronic
1188803082 X:34555580-34555602 TCCATGGTTTGGAGTAAAAGAGG + Intergenic
1188938938 X:36213511-36213533 TCCATGTATTAGAATAAATTGGG + Intergenic
1189001636 X:36954048-36954070 CCCATGGTTTAGAGTAAATGAGG + Intergenic
1193392562 X:80946255-80946277 TCAATGAGTTAGAATAAAAATGG - Intergenic
1193408644 X:81136011-81136033 TTCATAGTTTAGCAGAAAAGTGG - Intronic
1193695696 X:84705178-84705200 TCCATAGTTTGGAGTAAATGAGG - Intergenic
1193892636 X:87069305-87069327 TCCATTGTTTTACATAAAAGGGG - Intergenic
1193958795 X:87897771-87897793 TTCATGATTTGGAATAAATGAGG - Intergenic
1194138104 X:90173415-90173437 TCCATGATTTGGAGTAAAAAAGG - Intergenic
1195558715 X:106258092-106258114 TCCATGGTTTGGAGTAAAAGAGG - Intergenic
1196097546 X:111816156-111816178 TGCATGGGTAACAATAAAAGTGG + Intronic
1196899993 X:120373566-120373588 TCCATCATTTAGAATCAAATTGG + Intronic
1197608701 X:128614426-128614448 TTAATGGTTTAAAATGAAAGTGG + Intergenic
1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG + Intergenic
1199105799 X:143866128-143866150 TCCATTGTTTGGAGTAAATGAGG + Intergenic
1199130664 X:144182479-144182501 TCCATTGTTTGGAATTAATGTGG - Intergenic
1199233466 X:145466102-145466124 TCCGTGGTTTGGAATAAAAGAGG - Intergenic
1199579516 X:149347296-149347318 TCCAGGGCTTAGAATCTAAGCGG + Intergenic
1200483899 Y:3743669-3743691 TCCATGATTTGGAGTAAAAAAGG - Intergenic
1201711907 Y:17001741-17001763 TCCATTCTTTAAAATAAAAAGGG + Intergenic