ID: 1203447864

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:76691-76713
Sequence ACATGGCATCTGTACAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203447864_1203447868 11 Left 1203447864 Un_GL000219v1:76691-76713 CCTAGCTTGTACAGATGCCATGT No data
Right 1203447868 Un_GL000219v1:76725-76747 TGGTGACAGAAGGAATTTAAAGG No data
1203447864_1203447867 1 Left 1203447864 Un_GL000219v1:76691-76713 CCTAGCTTGTACAGATGCCATGT No data
Right 1203447867 Un_GL000219v1:76715-76737 ACTCTAGATTTGGTGACAGAAGG No data
1203447864_1203447865 -9 Left 1203447864 Un_GL000219v1:76691-76713 CCTAGCTTGTACAGATGCCATGT No data
Right 1203447865 Un_GL000219v1:76705-76727 ATGCCATGTAACTCTAGATTTGG No data
1203447864_1203447870 27 Left 1203447864 Un_GL000219v1:76691-76713 CCTAGCTTGTACAGATGCCATGT No data
Right 1203447870 Un_GL000219v1:76741-76763 TTAAAGGCTAGAACTAGATAGGG No data
1203447864_1203447869 26 Left 1203447864 Un_GL000219v1:76691-76713 CCTAGCTTGTACAGATGCCATGT No data
Right 1203447869 Un_GL000219v1:76740-76762 TTTAAAGGCTAGAACTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203447864 Original CRISPR ACATGGCATCTGTACAAGCT AGG (reversed) Intergenic
No off target data available for this crispr