ID: 1203449936

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:102761-102783
Sequence CTATTCTGACTGGTATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203449936_1203449939 13 Left 1203449936 Un_GL000219v1:102761-102783 CCATCCTATACCAGTCAGAATAG No data
Right 1203449939 Un_GL000219v1:102797-102819 AATCGAAAAACAACAGATCTTGG No data
1203449936_1203449940 14 Left 1203449936 Un_GL000219v1:102761-102783 CCATCCTATACCAGTCAGAATAG No data
Right 1203449940 Un_GL000219v1:102798-102820 ATCGAAAAACAACAGATCTTGGG No data
1203449936_1203449942 23 Left 1203449936 Un_GL000219v1:102761-102783 CCATCCTATACCAGTCAGAATAG No data
Right 1203449942 Un_GL000219v1:102807-102829 CAACAGATCTTGGGAGGCTGTGG No data
1203449936_1203449941 17 Left 1203449936 Un_GL000219v1:102761-102783 CCATCCTATACCAGTCAGAATAG No data
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203449936 Original CRISPR CTATTCTGACTGGTATAGGA TGG (reversed) Intergenic
No off target data available for this crispr