ID: 1203449937

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:102765-102787
Sequence GTAGCTATTCTGACTGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203449937_1203449944 28 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449944 Un_GL000219v1:102816-102838 TTGGGAGGCTGTGGAGAAAAGGG No data
1203449937_1203449939 9 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449939 Un_GL000219v1:102797-102819 AATCGAAAAACAACAGATCTTGG No data
1203449937_1203449943 27 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449943 Un_GL000219v1:102815-102837 CTTGGGAGGCTGTGGAGAAAAGG No data
1203449937_1203449941 13 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data
1203449937_1203449942 19 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449942 Un_GL000219v1:102807-102829 CAACAGATCTTGGGAGGCTGTGG No data
1203449937_1203449940 10 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449940 Un_GL000219v1:102798-102820 ATCGAAAAACAACAGATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203449937 Original CRISPR GTAGCTATTCTGACTGGTAT AGG (reversed) Intergenic
No off target data available for this crispr