ID: 1203449938

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:102771-102793
Sequence TTAATAGTAGCTATTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12812
Summary {0: 21, 1: 355, 2: 1912, 3: 4472, 4: 6052}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203449938_1203449943 21 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449943 Un_GL000219v1:102815-102837 CTTGGGAGGCTGTGGAGAAAAGG No data
1203449938_1203449942 13 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449942 Un_GL000219v1:102807-102829 CAACAGATCTTGGGAGGCTGTGG No data
1203449938_1203449939 3 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449939 Un_GL000219v1:102797-102819 AATCGAAAAACAACAGATCTTGG No data
1203449938_1203449944 22 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449944 Un_GL000219v1:102816-102838 TTGGGAGGCTGTGGAGAAAAGGG No data
1203449938_1203449940 4 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449940 Un_GL000219v1:102798-102820 ATCGAAAAACAACAGATCTTGGG No data
1203449938_1203449941 7 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203449938 Original CRISPR TTAATAGTAGCTATTCTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr