ID: 1203449941

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000219v1:102801-102823
Sequence GAAAAACAACAGATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203449938_1203449941 7 Left 1203449938 Un_GL000219v1:102771-102793 CCAGTCAGAATAGCTACTATTAA 0: 21
1: 355
2: 1912
3: 4472
4: 6052
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data
1203449935_1203449941 30 Left 1203449935 Un_GL000219v1:102748-102770 CCAAAATGAGATACCATCCTATA No data
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data
1203449937_1203449941 13 Left 1203449937 Un_GL000219v1:102765-102787 CCTATACCAGTCAGAATAGCTAC No data
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data
1203449936_1203449941 17 Left 1203449936 Un_GL000219v1:102761-102783 CCATCCTATACCAGTCAGAATAG No data
Right 1203449941 Un_GL000219v1:102801-102823 GAAAAACAACAGATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203449941 Original CRISPR GAAAAACAACAGATCTTGGG AGG Intergenic
No off target data available for this crispr